Mutagenetix > Incidental Mutation

Incidental Mutation 'R7755:2700049A03Rik'

597516

Institutional Source

Beutler Lab

Gene Symbol

2700049A03Rik

Ensembl Gene

ENSMUSG00000034601

Gene Name

RIKEN cDNA 2700049A03 gene

Synonyms

talpid3, Ta3

MMRRC Submission

045811-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7755 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71183622-71290077 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 71236187 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 1179 (M1179I)

Ref Sequence

ENSEMBL: ENSMUSP00000118956 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045907] [ENSMUST00000149564]

AlphaFold

E9PV87

Predicted Effect

probably benign
Transcript: ENSMUST00000045907
AA Change: M1179I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: M1179I

Domain	Start	End	E-Value	Type
Pfam:TALPID3	116	1351	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000149564
AA Change: M1179I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: M1179I

Domain	Start	End	E-Value	Type
Pfam:TALPID3	116	1349	N/A	PFAM

Meta Mutation Damage Score

0.1243

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402F06Rik	T	C	2: 35,266,349 (GRCm39)	Y107C	probably damaging	Het
Aff4	T	C	11: 53,289,206 (GRCm39)	S452P	probably damaging	Het
Astn2	T	C	4: 65,712,795 (GRCm39)	D615G	probably damaging	Het
Begain	A	G	12: 109,018,802 (GRCm39)	L215P	probably benign	Het
Carf	T	A	1: 60,187,214 (GRCm39)	S606T	probably benign	Het
Cngb3	A	T	4: 19,461,684 (GRCm39)	T522S	probably benign	Het
Ctsll3	A	T	13: 60,948,219 (GRCm39)	F153I	probably damaging	Het
Cubn	G	A	2: 13,284,889 (GRCm39)	T3509I	probably benign	Het
Dmrta1	T	C	4: 89,580,170 (GRCm39)	S377P	probably benign	Het
Dnmbp	G	A	19: 43,838,525 (GRCm39)	A659V	probably benign	Het
Dspp	TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG	TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG	5: 104,326,227 (GRCm39)		probably benign	Het
Dync2h1	T	C	9: 7,015,490 (GRCm39)	D3598G	probably benign	Het
Elp1	T	C	4: 56,774,552 (GRCm39)	N779S	possibly damaging	Het
Flot2	T	C	11: 77,940,339 (GRCm39)	F29L	probably benign	Het
Hectd1	A	T	12: 51,849,003 (GRCm39)	I367K	possibly damaging	Het
Ivl	T	A	3: 92,479,317 (GRCm39)	K249N	probably damaging	Het
Khnyn	A	G	14: 56,125,425 (GRCm39)	T503A	probably damaging	Het
Mbd4	T	A	6: 115,821,546 (GRCm39)	I490F	probably damaging	Het
Mlip	T	C	9: 77,136,838 (GRCm39)	T690A	probably benign	Het
Mmp1a	T	A	9: 7,467,005 (GRCm39)	D227E	possibly damaging	Het
Mrgprf	T	C	7: 144,862,380 (GRCm39)	L314P	probably damaging	Het
Ndufb9	T	G	15: 58,808,255 (GRCm39)	Y80*	probably null	Het
Neto2	C	T	8: 86,396,285 (GRCm39)	R155H	probably damaging	Het
Npat	T	A	9: 53,470,470 (GRCm39)	N365K	possibly damaging	Het
Nsl1	G	A	1: 190,795,380 (GRCm39)	V49M	probably benign	Het
Nudt21	T	A	8: 94,749,493 (GRCm39)	Y191F	probably benign	Het
Or2w25	A	G	11: 59,504,467 (GRCm39)	R226G	probably damaging	Het
Or8b54	T	G	9: 38,687,073 (GRCm39)	I174S	possibly damaging	Het
Pcdh18	T	C	3: 49,709,278 (GRCm39)	Y679C	possibly damaging	Het
Pkd1l3	A	G	8: 110,356,798 (GRCm39)	D741G	possibly damaging	Het
Pkhd1	T	C	1: 20,617,717 (GRCm39)	D956G	probably damaging	Het
Poglut2	T	C	1: 44,157,733 (GRCm39)		probably benign	Het
Pparg	C	T	6: 115,440,067 (GRCm39)	P214S	probably damaging	Het
Ppargc1a	T	A	5: 51,630,883 (GRCm39)	Y582F	unknown	Het
Prdm9	C	T	17: 15,765,226 (GRCm39)	C518Y	probably damaging	Het
Rangrf	T	A	11: 68,864,540 (GRCm39)	E2V	probably damaging	Het
Rpl19	T	C	11: 97,919,193 (GRCm39)	I45T	probably benign	Het
Rtn4rl2	T	C	2: 84,702,807 (GRCm39)	D255G	possibly damaging	Het
Shld2	T	C	14: 33,970,847 (GRCm39)	K627E	probably damaging	Het
Sirt3	T	C	7: 140,457,963 (GRCm39)	D62G		Het
Slc22a30	T	C	19: 8,314,133 (GRCm39)	T518A	probably damaging	Het
Slc40a1	T	C	1: 45,950,466 (GRCm39)	T329A	probably damaging	Het
Slc6a17	C	T	3: 107,381,671 (GRCm39)	G470D	probably damaging	Het
Syne2	A	T	12: 76,044,181 (GRCm39)	I3923L	probably benign	Het
Tiam2	C	T	17: 3,471,591 (GRCm39)	S411L	probably benign	Het
Ticam1	A	G	17: 56,577,182 (GRCm39)	C638R	unknown	Het
Tnrc6c	A	G	11: 117,648,912 (GRCm39)	T1528A	probably benign	Het
Ufl1	A	G	4: 25,262,274 (GRCm39)	I404T	probably benign	Het
Usp43	A	T	11: 67,782,294 (GRCm39)	S375T	possibly damaging	Het
Vmn2r88	C	G	14: 51,650,503 (GRCm39)	A72G	probably benign	Het
Vmn2r91	A	T	17: 18,330,311 (GRCm39)	I532F	possibly damaging	Het
Vmn2r95	T	C	17: 18,644,367 (GRCm39)	M1T	probably null	Het
Xirp2	T	C	2: 67,345,526 (GRCm39)	V2589A	probably benign	Het
Zfp128	C	T	7: 12,624,240 (GRCm39)	Q203*	probably null	Het

Other mutations in 2700049A03Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:2700049A03Rik	APN	12	71,213,893 (GRCm39)	missense	probably benign	0.00
IGL01107:2700049A03Rik	APN	12	71,241,242 (GRCm39)	critical splice donor site	probably null
IGL01404:2700049A03Rik	APN	12	71,211,152 (GRCm39)	splice site	probably null
IGL01835:2700049A03Rik	APN	12	71,213,957 (GRCm39)	missense	probably benign	0.00
IGL01835:2700049A03Rik	APN	12	71,213,955 (GRCm39)	nonsense	probably null
IGL02122:2700049A03Rik	APN	12	71,217,299 (GRCm39)	missense	possibly damaging	0.93
IGL02140:2700049A03Rik	APN	12	71,195,034 (GRCm39)	missense	probably benign	0.06
IGL02385:2700049A03Rik	APN	12	71,201,630 (GRCm39)	missense	probably damaging	0.98
IGL03181:2700049A03Rik	APN	12	71,240,147 (GRCm39)	missense	possibly damaging	0.51
IGL03253:2700049A03Rik	APN	12	71,187,657 (GRCm39)	missense	probably benign	0.33
IGL03278:2700049A03Rik	APN	12	71,205,599 (GRCm39)	splice site	probably benign
G4846:2700049A03Rik	UTSW	12	71,184,683 (GRCm39)	missense	probably benign
PIT1430001:2700049A03Rik	UTSW	12	71,207,160 (GRCm39)	missense	possibly damaging	0.71
PIT4519001:2700049A03Rik	UTSW	12	71,217,440 (GRCm39)	missense	probably benign	0.05
R0108:2700049A03Rik	UTSW	12	71,224,692 (GRCm39)	missense	probably benign	0.14
R0165:2700049A03Rik	UTSW	12	71,213,924 (GRCm39)	missense	possibly damaging	0.52
R0211:2700049A03Rik	UTSW	12	71,262,870 (GRCm39)	missense	possibly damaging	0.96
R0211:2700049A03Rik	UTSW	12	71,262,870 (GRCm39)	missense	possibly damaging	0.96
R0220:2700049A03Rik	UTSW	12	71,195,194 (GRCm39)	critical splice donor site	probably null
R0352:2700049A03Rik	UTSW	12	71,184,804 (GRCm39)	missense	possibly damaging	0.96
R0468:2700049A03Rik	UTSW	12	71,240,084 (GRCm39)	missense	possibly damaging	0.71
R0508:2700049A03Rik	UTSW	12	71,211,162 (GRCm39)	missense	probably damaging	0.98
R0673:2700049A03Rik	UTSW	12	71,224,642 (GRCm39)	missense	probably damaging	0.97
R0840:2700049A03Rik	UTSW	12	71,205,657 (GRCm39)	missense	probably benign	0.16
R0893:2700049A03Rik	UTSW	12	71,266,082 (GRCm39)	splice site	probably benign
R1244:2700049A03Rik	UTSW	12	71,262,918 (GRCm39)	missense	probably benign	0.25
R1432:2700049A03Rik	UTSW	12	71,217,361 (GRCm39)	splice site	probably null
R1599:2700049A03Rik	UTSW	12	71,197,033 (GRCm39)	missense	probably damaging	0.98
R1732:2700049A03Rik	UTSW	12	71,265,995 (GRCm39)	missense	probably benign	0.18
R1820:2700049A03Rik	UTSW	12	71,197,018 (GRCm39)	missense	possibly damaging	0.51
R1939:2700049A03Rik	UTSW	12	71,207,186 (GRCm39)	splice site	probably null
R1998:2700049A03Rik	UTSW	12	71,235,393 (GRCm39)	missense	possibly damaging	0.86
R2337:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2337:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2340:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2340:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2382:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2382:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2384:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2384:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2445:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2445:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2449:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2449:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2512:2700049A03Rik	UTSW	12	71,219,945 (GRCm39)	missense	possibly damaging	0.71
R2872:2700049A03Rik	UTSW	12	71,201,530 (GRCm39)	splice site	probably benign
R3236:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3236:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3237:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3237:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3734:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3734:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3808:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3808:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3809:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3809:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3944:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3944:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3959:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3959:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3960:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3960:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4593:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4593:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4595:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4595:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4596:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4596:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4600:2700049A03Rik	UTSW	12	71,195,037 (GRCm39)	missense	possibly damaging	0.67
R4649:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4649:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4651:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4651:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4652:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4652:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4714:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4714:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4735:2700049A03Rik	UTSW	12	71,262,897 (GRCm39)	missense	possibly damaging	0.88
R4810:2700049A03Rik	UTSW	12	71,236,216 (GRCm39)	missense	possibly damaging	0.51
R4852:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4852:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4854:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4854:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4855:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4855:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4884:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4884:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4893:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4893:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4905:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4905:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4915:2700049A03Rik	UTSW	12	71,236,420 (GRCm39)	missense	possibly damaging	0.92
R4919:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4919:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4959:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4959:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4989:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4989:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5011:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5011:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5012:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5012:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5118:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5118:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5146:2700049A03Rik	UTSW	12	71,289,799 (GRCm39)	missense	possibly damaging	0.85
R5163:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5163:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5188:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5188:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5189:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5189:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5189:2700049A03Rik	UTSW	12	71,240,123 (GRCm39)	missense	possibly damaging	0.93
R5190:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5190:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5290:2700049A03Rik	UTSW	12	71,235,565 (GRCm39)	missense	probably benign	0.00
R5344:2700049A03Rik	UTSW	12	71,289,801 (GRCm39)	missense	probably benign
R5502:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5502:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5503:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5503:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5619:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5619:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5667:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5667:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5669:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5669:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5671:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5671:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5725:2700049A03Rik	UTSW	12	71,240,093 (GRCm39)	missense	probably benign	0.05
R5956:2700049A03Rik	UTSW	12	71,203,893 (GRCm39)	missense	possibly damaging	0.86
R6051:2700049A03Rik	UTSW	12	71,231,304 (GRCm39)	missense	possibly damaging	0.84
R6148:2700049A03Rik	UTSW	12	71,234,200 (GRCm39)	missense	possibly damaging	0.71
R6158:2700049A03Rik	UTSW	12	71,217,410 (GRCm39)	missense	possibly damaging	0.51
R6916:2700049A03Rik	UTSW	12	71,211,318 (GRCm39)	missense	possibly damaging	0.86
R7129:2700049A03Rik	UTSW	12	71,263,004 (GRCm39)	splice site	probably null
R7168:2700049A03Rik	UTSW	12	71,262,831 (GRCm39)	missense	probably damaging	0.98
R7193:2700049A03Rik	UTSW	12	71,265,963 (GRCm39)	critical splice acceptor site	probably null
R7200:2700049A03Rik	UTSW	12	71,187,680 (GRCm39)	missense	probably damaging	0.96
R7359:2700049A03Rik	UTSW	12	71,236,348 (GRCm39)	missense	possibly damaging	0.51
R7488:2700049A03Rik	UTSW	12	71,197,179 (GRCm39)	missense	possibly damaging	0.67
R7757:2700049A03Rik	UTSW	12	71,236,187 (GRCm39)	missense	probably benign	0.02
R7922:2700049A03Rik	UTSW	12	71,211,180 (GRCm39)	missense	possibly damaging	0.83
R7966:2700049A03Rik	UTSW	12	71,219,903 (GRCm39)	missense	probably benign	0.00
R8082:2700049A03Rik	UTSW	12	71,188,895 (GRCm39)	critical splice donor site	probably null
R8311:2700049A03Rik	UTSW	12	71,184,815 (GRCm39)	unclassified	probably benign
R8408:2700049A03Rik	UTSW	12	71,236,356 (GRCm39)	missense	possibly damaging	0.71
R8852:2700049A03Rik	UTSW	12	71,231,197 (GRCm39)	missense	possibly damaging	0.93
R8860:2700049A03Rik	UTSW	12	71,231,197 (GRCm39)	missense	possibly damaging	0.93
R9039:2700049A03Rik	UTSW	12	71,213,849 (GRCm39)	missense	possibly damaging	0.51
R9281:2700049A03Rik	UTSW	12	71,205,687 (GRCm39)	missense	possibly damaging	0.51
R9308:2700049A03Rik	UTSW	12	71,231,233 (GRCm39)	missense	probably benign	0.23
R9385:2700049A03Rik	UTSW	12	71,207,966 (GRCm39)	missense	possibly damaging	0.52
R9412:2700049A03Rik	UTSW	12	71,235,457 (GRCm39)	missense	possibly damaging	0.71
R9643:2700049A03Rik	UTSW	12	71,211,189 (GRCm39)	missense	possibly damaging	0.92
R9676:2700049A03Rik	UTSW	12	71,207,905 (GRCm39)	missense	possibly damaging	0.86
R9776:2700049A03Rik	UTSW	12	71,235,448 (GRCm39)	missense	possibly damaging	0.71
R9789:2700049A03Rik	UTSW	12	71,231,357 (GRCm39)	missense	probably benign
Z1177:2700049A03Rik	UTSW	12	71,211,258 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATCATCAGATGCTGTGCG -3'
(R):5'- TCAGTGACAGTGCTCAGAGTG -3'

Sequencing Primer
(F):5'- ACCATATTGATTCCTTTTGTGGCTAG -3'
(R):5'- ACAGTGCTCAGAGTGTTCTCCAG -3'

Posted On

2019-11-26