Incidental Mutation 'R0632:Fbn2'
ID 59752
Institutional Source Beutler Lab
Gene Symbol Fbn2
Ensembl Gene ENSMUSG00000024598
Gene Name fibrillin 2
Synonyms sy, Sne, Fib-2
MMRRC Submission 038821-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.917) question?
Stock # R0632 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 58141689-58343200 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58170819 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 2191 (C2191R)
Ref Sequence ENSEMBL: ENSMUSP00000025497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025497]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000025497
AA Change: C2191R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025497
Gene: ENSMUSG00000024598
AA Change: C2191R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 29 52 N/A INTRINSIC
low complexity region 68 77 N/A INTRINSIC
EGF 148 176 1.15e1 SMART
EGF 179 208 1.26e-2 SMART
Pfam:TB 224 262 3.7e-10 PFAM
EGF_CA 276 317 8.3e-12 SMART
EGF_CA 318 359 9.25e-10 SMART
Pfam:TB 374 416 4.3e-13 PFAM
low complexity region 435 450 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
EGF 490 527 1.13e-4 SMART
EGF_CA 528 567 2.26e-13 SMART
EGF_CA 568 609 9.03e-13 SMART
EGF_CA 610 650 6.2e-11 SMART
EGF_CA 651 691 7.75e-12 SMART
Pfam:TB 707 748 5.2e-15 PFAM
EGF_CA 761 802 6.29e-12 SMART
EGF_CA 803 844 1.97e-13 SMART
EGF_CA 845 884 1.61e-9 SMART
Pfam:TB 899 935 1.8e-9 PFAM
EGF_CA 948 989 4.7e-11 SMART
Pfam:TB 1004 1044 1.3e-16 PFAM
EGF_CA 1066 1107 3.05e-10 SMART
EGF_CA 1108 1150 2.19e-11 SMART
EGF_CA 1151 1192 2.04e-11 SMART
EGF_CA 1193 1234 3.15e-12 SMART
EGF_CA 1235 1275 1.82e-8 SMART
EGF_CA 1276 1317 9.91e-10 SMART
EGF_CA 1318 1359 1.48e-8 SMART
EGF_CA 1360 1400 6.54e-10 SMART
EGF_CA 1401 1441 4.63e-10 SMART
EGF_CA 1442 1483 7.75e-12 SMART
EGF_CA 1484 1524 5.23e-9 SMART
EGF_CA 1525 1565 2.13e-9 SMART
Pfam:TB 1585 1625 3.4e-15 PFAM
EGF_CA 1643 1684 6.74e-12 SMART
EGF_CA 1685 1726 1.06e-9 SMART
Pfam:TB 1741 1783 1.2e-17 PFAM
EGF_CA 1801 1842 7.34e-13 SMART
EGF_CA 1843 1884 4.15e-12 SMART
EGF_CA 1885 1926 5.23e-9 SMART
EGF_CA 1927 1965 5.87e-12 SMART
EGF_CA 1966 2008 1.11e-12 SMART
EGF_CA 2009 2048 1.26e-11 SMART
EGF_CA 2049 2090 7.12e-11 SMART
Pfam:TB 2105 2147 1.2e-15 PFAM
EGF_CA 2164 2205 2.89e-11 SMART
EGF_CA 2206 2245 1.1e-11 SMART
EGF_CA 2246 2286 3.76e-10 SMART
EGF_CA 2287 2330 1.44e-6 SMART
EGF_CA 2331 2372 1.16e-10 SMART
Pfam:TB 2387 2429 1.9e-16 PFAM
EGF_CA 2442 2483 8.43e-13 SMART
EGF_CA 2484 2524 4.96e-10 SMART
EGF_CA 2525 2563 7.63e-11 SMART
EGF_CA 2564 2606 6.44e-9 SMART
EGF_CA 2607 2646 2.28e-9 SMART
EGF_CA 2647 2687 1.79e-7 SMART
EGF_CA 2688 2727 3.45e-9 SMART
low complexity region 2774 2786 N/A INTRINSIC
Meta Mutation Damage Score 0.9400 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of connective tissue microfibrils and may be involved in elastic fiber assembly. Mutations in this gene cause congenital contractural arachnodactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous, chemically-induced, and targeted null mutations show bilateral syndactyly with fusion of both soft and hard tissues. Deafness found in an X-ray induced allelic mutant is apparently due to the joint disruption of a linked gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a T A 9: 119,176,884 (GRCm39) probably benign Het
Adgrg7 T A 16: 56,562,952 (GRCm39) T462S possibly damaging Het
Akap6 A T 12: 52,983,931 (GRCm39) N825I probably damaging Het
Ankib1 T A 5: 3,822,529 (GRCm39) N59I probably benign Het
Anks6 T C 4: 47,033,167 (GRCm39) S633G possibly damaging Het
Ap4e1 C A 2: 126,891,200 (GRCm39) Y522* probably null Het
Art5 G A 7: 101,747,164 (GRCm39) T205I probably damaging Het
Ascc2 T A 11: 4,599,855 (GRCm39) L176H probably damaging Het
Atp13a5 T C 16: 29,117,026 (GRCm39) D529G probably benign Het
C2cd4a T C 9: 67,738,845 (GRCm39) E66G probably benign Het
C8a T C 4: 104,713,689 (GRCm39) D147G probably damaging Het
Ccdc14 T C 16: 34,542,019 (GRCm39) V532A possibly damaging Het
Ccdc88a T A 11: 29,432,749 (GRCm39) probably benign Het
Cfap54 C T 10: 92,720,958 (GRCm39) E2543K unknown Het
Cldn13 C T 5: 134,943,601 (GRCm39) E195K probably benign Het
Cp A G 3: 20,025,246 (GRCm39) S402G probably null Het
Cpa3 T C 3: 20,279,358 (GRCm39) T194A probably benign Het
Crygf C A 1: 65,967,156 (GRCm39) Y93* probably null Het
Ctsh A G 9: 89,943,635 (GRCm39) R87G possibly damaging Het
Cyp2t4 A G 7: 26,857,671 (GRCm39) D428G possibly damaging Het
Dnah17 C G 11: 117,958,508 (GRCm39) probably benign Het
Dnah3 A G 7: 119,567,128 (GRCm39) V2366A probably benign Het
Dscaml1 A T 9: 45,643,432 (GRCm39) I1284F probably benign Het
Dsg1c T C 18: 20,405,403 (GRCm39) probably benign Het
Dst G T 1: 34,310,494 (GRCm39) R4098L probably damaging Het
Efhb A G 17: 53,720,487 (GRCm39) probably benign Het
Epha7 A T 4: 28,821,104 (GRCm39) I90F probably damaging Het
Fam171a2 T A 11: 102,328,707 (GRCm39) D684V probably damaging Het
Fan1 A G 7: 64,012,947 (GRCm39) V665A possibly damaging Het
Fkbp3 G A 12: 65,120,692 (GRCm39) A2V probably benign Het
G6pd2 A G 5: 61,967,514 (GRCm39) N430D probably benign Het
Gm13547 T A 2: 29,651,596 (GRCm39) D7E possibly damaging Het
H4c9 G T 13: 22,225,197 (GRCm39) Y99* probably null Het
Hdac5 A T 11: 102,096,638 (GRCm39) D260E probably damaging Het
Hsf2bp T C 17: 32,232,320 (GRCm39) E142G probably damaging Het
Igf1r C T 7: 67,814,903 (GRCm39) T268I probably damaging Het
Inava T C 1: 136,155,356 (GRCm39) D83G probably benign Het
Kcne3 C T 7: 99,833,646 (GRCm39) R88C probably damaging Het
Klk1b9 G T 7: 43,628,796 (GRCm39) G100V possibly damaging Het
Kmt2d G A 15: 98,751,462 (GRCm39) probably benign Het
Lama1 C T 17: 68,059,363 (GRCm39) probably benign Het
Lcp2 C T 11: 34,032,426 (GRCm39) P335S possibly damaging Het
Lrrk2 T A 15: 91,680,231 (GRCm39) N2047K probably damaging Het
Mcub T C 3: 129,712,375 (GRCm39) M167V probably benign Het
Mia2 T C 12: 59,182,929 (GRCm39) L36P probably damaging Het
Mmp13 G A 9: 7,274,032 (GRCm39) G169R probably damaging Het
Mmp13 A T 9: 7,282,077 (GRCm39) I460F possibly damaging Het
Msh4 A G 3: 153,602,532 (GRCm39) I232T probably damaging Het
Msra T A 14: 64,447,981 (GRCm39) M145L probably benign Het
Myo7a A T 7: 97,761,357 (GRCm39) probably benign Het
Nme8 A T 13: 19,842,206 (GRCm39) N422K probably damaging Het
Nol6 A T 4: 41,121,115 (GRCm39) F353I probably damaging Het
Nphp3 A G 9: 103,895,473 (GRCm39) K384E probably damaging Het
Or51h5 C T 7: 102,577,811 (GRCm39) probably null Het
Or52e15 A G 7: 104,645,910 (GRCm39) I67T probably benign Het
Or52h7 A G 7: 104,213,544 (GRCm39) I39V probably benign Het
Phox2b T G 5: 67,253,557 (GRCm39) probably benign Het
Plec A T 15: 76,057,611 (GRCm39) S4131T probably damaging Het
Pptc7 G A 5: 122,451,654 (GRCm39) probably benign Het
Pramel31 G A 4: 144,090,352 (GRCm39) C464Y probably damaging Het
Prpf40b A G 15: 99,214,170 (GRCm39) E810G probably benign Het
Ptprc C T 1: 138,001,348 (GRCm39) V965I probably benign Het
Pum1 T A 4: 130,455,415 (GRCm39) M180K probably benign Het
Ranbp3 T C 17: 57,009,896 (GRCm39) probably benign Het
Rasgrf2 A G 13: 92,120,393 (GRCm39) S787P probably benign Het
Rnf19b T A 4: 128,967,344 (GRCm39) N294K probably damaging Het
Samd3 A T 10: 26,120,393 (GRCm39) H156L possibly damaging Het
Serpinb6c C T 13: 34,064,014 (GRCm39) R347Q possibly damaging Het
Slc36a3 A G 11: 55,015,906 (GRCm39) I416T probably damaging Het
Slc4a4 T A 5: 89,277,500 (GRCm39) F279Y probably damaging Het
Slc6a2 T A 8: 93,719,429 (GRCm39) probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Tab2 A G 10: 7,795,565 (GRCm39) S232P probably benign Het
Tacc2 A T 7: 130,227,325 (GRCm39) K1356* probably null Het
Tmem87a A G 2: 120,190,023 (GRCm39) S544P probably damaging Het
Trim52 T A 14: 106,344,401 (GRCm39) C20S probably damaging Het
Usp38 A T 8: 81,740,779 (GRCm39) V96E probably benign Het
Vmn2r59 T C 7: 41,708,308 (GRCm39) Y33C probably damaging Het
Vsig10l T G 7: 43,113,561 (GRCm39) V171G probably damaging Het
Zfp957 T A 14: 79,450,360 (GRCm39) I480F probably damaging Het
Other mutations in Fbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Fbn2 APN 18 58,170,881 (GRCm39) missense possibly damaging 0.81
IGL00780:Fbn2 APN 18 58,229,060 (GRCm39) missense probably damaging 1.00
IGL00923:Fbn2 APN 18 58,145,397 (GRCm39) missense probably benign 0.00
IGL01011:Fbn2 APN 18 58,228,312 (GRCm39) splice site probably benign
IGL01123:Fbn2 APN 18 58,237,153 (GRCm39) missense possibly damaging 0.62
IGL01304:Fbn2 APN 18 58,194,817 (GRCm39) missense probably damaging 0.97
IGL01339:Fbn2 APN 18 58,246,442 (GRCm39) missense possibly damaging 0.75
IGL01465:Fbn2 APN 18 58,336,905 (GRCm39) missense probably null 0.67
IGL01608:Fbn2 APN 18 58,186,776 (GRCm39) nonsense probably null
IGL01682:Fbn2 APN 18 58,205,743 (GRCm39) missense probably damaging 1.00
IGL01752:Fbn2 APN 18 58,209,049 (GRCm39) splice site probably null
IGL01764:Fbn2 APN 18 58,178,423 (GRCm39) missense probably damaging 1.00
IGL02002:Fbn2 APN 18 58,247,625 (GRCm39) missense probably benign 0.01
IGL02010:Fbn2 APN 18 58,170,794 (GRCm39) missense probably damaging 0.99
IGL02029:Fbn2 APN 18 58,342,675 (GRCm39) missense probably benign 0.04
IGL02037:Fbn2 APN 18 58,229,087 (GRCm39) missense probably damaging 1.00
IGL02350:Fbn2 APN 18 58,237,067 (GRCm39) missense possibly damaging 0.71
IGL02357:Fbn2 APN 18 58,237,067 (GRCm39) missense possibly damaging 0.71
IGL02653:Fbn2 APN 18 58,209,777 (GRCm39) missense probably benign
IGL03233:Fbn2 APN 18 58,235,449 (GRCm39) missense probably benign 0.39
IGL03347:Fbn2 APN 18 58,146,737 (GRCm39) missense probably damaging 1.00
IGL03410:Fbn2 APN 18 58,183,315 (GRCm39) missense possibly damaging 0.95
pinch UTSW 18 58,202,256 (GRCm39) missense probably damaging 1.00
stick UTSW 18 58,204,891 (GRCm39) missense possibly damaging 0.94
tweak UTSW 18 58,191,461 (GRCm39) missense probably damaging 1.00
BB009:Fbn2 UTSW 18 58,153,555 (GRCm39) missense possibly damaging 0.61
BB019:Fbn2 UTSW 18 58,153,555 (GRCm39) missense possibly damaging 0.61
PIT4434001:Fbn2 UTSW 18 58,229,134 (GRCm39) missense probably damaging 0.99
R0020:Fbn2 UTSW 18 58,238,236 (GRCm39) missense probably damaging 1.00
R0069:Fbn2 UTSW 18 58,202,256 (GRCm39) missense probably damaging 1.00
R0107:Fbn2 UTSW 18 58,189,275 (GRCm39) missense probably benign 0.00
R0116:Fbn2 UTSW 18 58,235,445 (GRCm39) nonsense probably null
R0277:Fbn2 UTSW 18 58,178,389 (GRCm39) missense probably damaging 1.00
R0284:Fbn2 UTSW 18 58,183,362 (GRCm39) splice site probably benign
R0316:Fbn2 UTSW 18 58,246,397 (GRCm39) missense probably damaging 1.00
R0323:Fbn2 UTSW 18 58,178,389 (GRCm39) missense probably damaging 1.00
R0421:Fbn2 UTSW 18 58,160,876 (GRCm39) splice site probably benign
R0455:Fbn2 UTSW 18 58,168,408 (GRCm39) missense probably damaging 1.00
R0504:Fbn2 UTSW 18 58,172,532 (GRCm39) missense possibly damaging 0.94
R0520:Fbn2 UTSW 18 58,146,821 (GRCm39) missense probably damaging 1.00
R0638:Fbn2 UTSW 18 58,178,446 (GRCm39) missense probably damaging 0.98
R0645:Fbn2 UTSW 18 58,191,461 (GRCm39) missense probably damaging 1.00
R1051:Fbn2 UTSW 18 58,145,425 (GRCm39) missense probably damaging 0.99
R1209:Fbn2 UTSW 18 58,203,088 (GRCm39) missense probably benign 0.00
R1319:Fbn2 UTSW 18 58,333,682 (GRCm39) missense possibly damaging 0.88
R1400:Fbn2 UTSW 18 58,213,265 (GRCm39) missense possibly damaging 0.90
R1437:Fbn2 UTSW 18 58,186,731 (GRCm39) missense possibly damaging 0.68
R1463:Fbn2 UTSW 18 58,143,452 (GRCm39) missense probably benign
R1612:Fbn2 UTSW 18 58,194,824 (GRCm39) missense probably damaging 1.00
R1623:Fbn2 UTSW 18 58,181,620 (GRCm39) missense possibly damaging 0.61
R1629:Fbn2 UTSW 18 58,159,610 (GRCm39) missense probably damaging 1.00
R1639:Fbn2 UTSW 18 58,191,534 (GRCm39) missense probably benign 0.41
R1722:Fbn2 UTSW 18 58,181,124 (GRCm39) critical splice acceptor site probably null
R1749:Fbn2 UTSW 18 58,183,348 (GRCm39) missense probably benign 0.35
R1802:Fbn2 UTSW 18 58,186,048 (GRCm39) nonsense probably null
R1850:Fbn2 UTSW 18 58,172,377 (GRCm39) splice site probably benign
R1913:Fbn2 UTSW 18 58,194,814 (GRCm39) missense probably damaging 1.00
R2045:Fbn2 UTSW 18 58,223,730 (GRCm39) missense probably damaging 1.00
R2064:Fbn2 UTSW 18 58,181,921 (GRCm39) missense probably damaging 0.99
R2143:Fbn2 UTSW 18 58,186,065 (GRCm39) missense possibly damaging 0.65
R2144:Fbn2 UTSW 18 58,186,065 (GRCm39) missense possibly damaging 0.65
R2149:Fbn2 UTSW 18 58,235,397 (GRCm39) splice site probably null
R2207:Fbn2 UTSW 18 58,214,471 (GRCm39) nonsense probably null
R2219:Fbn2 UTSW 18 58,186,035 (GRCm39) missense possibly damaging 0.79
R2263:Fbn2 UTSW 18 58,228,248 (GRCm39) splice site probably benign
R2375:Fbn2 UTSW 18 58,169,038 (GRCm39) missense probably damaging 1.00
R2424:Fbn2 UTSW 18 58,336,859 (GRCm39) missense probably damaging 0.99
R2504:Fbn2 UTSW 18 58,226,431 (GRCm39) missense probably damaging 0.99
R2879:Fbn2 UTSW 18 58,202,314 (GRCm39) missense probably damaging 0.97
R3040:Fbn2 UTSW 18 58,226,459 (GRCm39) missense probably damaging 1.00
R3080:Fbn2 UTSW 18 58,282,122 (GRCm39) missense probably damaging 0.97
R3625:Fbn2 UTSW 18 58,194,814 (GRCm39) missense probably damaging 1.00
R3901:Fbn2 UTSW 18 58,199,083 (GRCm39) missense probably damaging 0.97
R4089:Fbn2 UTSW 18 58,186,841 (GRCm39) missense probably benign 0.01
R4133:Fbn2 UTSW 18 58,229,034 (GRCm39) missense possibly damaging 0.82
R4155:Fbn2 UTSW 18 58,156,359 (GRCm39) nonsense probably null
R4288:Fbn2 UTSW 18 58,168,411 (GRCm39) missense probably damaging 0.98
R4289:Fbn2 UTSW 18 58,168,411 (GRCm39) missense probably damaging 0.98
R4363:Fbn2 UTSW 18 58,282,122 (GRCm39) missense probably damaging 0.97
R4559:Fbn2 UTSW 18 58,209,146 (GRCm39) missense probably benign 0.00
R4601:Fbn2 UTSW 18 58,186,805 (GRCm39) missense probably damaging 1.00
R4609:Fbn2 UTSW 18 58,323,341 (GRCm39) nonsense probably null
R4626:Fbn2 UTSW 18 58,146,819 (GRCm39) nonsense probably null
R4638:Fbn2 UTSW 18 58,143,376 (GRCm39) missense probably benign 0.01
R4675:Fbn2 UTSW 18 58,173,265 (GRCm39) missense possibly damaging 0.95
R4707:Fbn2 UTSW 18 58,189,344 (GRCm39) missense probably damaging 1.00
R4758:Fbn2 UTSW 18 58,159,458 (GRCm39) missense probably benign 0.00
R4945:Fbn2 UTSW 18 58,183,325 (GRCm39) missense possibly damaging 0.53
R4955:Fbn2 UTSW 18 58,191,455 (GRCm39) missense possibly damaging 0.61
R4980:Fbn2 UTSW 18 58,143,703 (GRCm39) missense probably benign 0.05
R4998:Fbn2 UTSW 18 58,205,703 (GRCm39) missense probably damaging 1.00
R5133:Fbn2 UTSW 18 58,172,412 (GRCm39) missense probably damaging 0.99
R5322:Fbn2 UTSW 18 58,172,387 (GRCm39) missense probably benign 0.00
R5414:Fbn2 UTSW 18 58,226,477 (GRCm39) missense probably damaging 0.96
R5538:Fbn2 UTSW 18 58,204,973 (GRCm39) missense probably benign 0.22
R5557:Fbn2 UTSW 18 58,248,731 (GRCm39) missense probably benign 0.00
R5754:Fbn2 UTSW 18 58,257,383 (GRCm39) missense probably benign 0.04
R5769:Fbn2 UTSW 18 58,238,271 (GRCm39) missense probably damaging 1.00
R5790:Fbn2 UTSW 18 58,209,768 (GRCm39) missense probably benign 0.34
R5830:Fbn2 UTSW 18 58,247,541 (GRCm39) missense probably benign 0.01
R5845:Fbn2 UTSW 18 58,186,840 (GRCm39) missense possibly damaging 0.89
R5880:Fbn2 UTSW 18 58,156,354 (GRCm39) nonsense probably null
R5907:Fbn2 UTSW 18 58,178,409 (GRCm39) missense probably damaging 1.00
R5948:Fbn2 UTSW 18 58,170,121 (GRCm39) missense probably damaging 1.00
R5955:Fbn2 UTSW 18 58,177,328 (GRCm39) missense probably damaging 1.00
R5974:Fbn2 UTSW 18 58,181,992 (GRCm39) missense probably damaging 1.00
R6010:Fbn2 UTSW 18 58,202,596 (GRCm39) missense probably benign 0.31
R6024:Fbn2 UTSW 18 58,209,908 (GRCm39) missense probably benign 0.03
R6037:Fbn2 UTSW 18 58,177,295 (GRCm39) missense probably benign 0.05
R6037:Fbn2 UTSW 18 58,177,295 (GRCm39) missense probably benign 0.05
R6315:Fbn2 UTSW 18 58,188,025 (GRCm39) critical splice acceptor site probably null
R6437:Fbn2 UTSW 18 58,246,435 (GRCm39) missense probably damaging 1.00
R6519:Fbn2 UTSW 18 58,196,647 (GRCm39) missense possibly damaging 0.61
R6520:Fbn2 UTSW 18 58,235,462 (GRCm39) missense probably damaging 1.00
R6734:Fbn2 UTSW 18 58,169,032 (GRCm39) missense probably damaging 1.00
R6755:Fbn2 UTSW 18 58,246,405 (GRCm39) missense possibly damaging 0.89
R6789:Fbn2 UTSW 18 58,143,686 (GRCm39) missense probably benign 0.00
R6801:Fbn2 UTSW 18 58,246,420 (GRCm39) missense probably benign 0.04
R6862:Fbn2 UTSW 18 58,257,393 (GRCm39) missense probably benign 0.04
R6900:Fbn2 UTSW 18 58,209,903 (GRCm39) missense probably benign
R6906:Fbn2 UTSW 18 58,204,891 (GRCm39) missense possibly damaging 0.94
R6919:Fbn2 UTSW 18 58,257,259 (GRCm39) splice site probably null
R6950:Fbn2 UTSW 18 58,168,993 (GRCm39) missense probably null 0.21
R6985:Fbn2 UTSW 18 58,201,460 (GRCm39) missense probably damaging 1.00
R7056:Fbn2 UTSW 18 58,209,798 (GRCm39) missense probably benign
R7199:Fbn2 UTSW 18 58,186,833 (GRCm39) nonsense probably null
R7219:Fbn2 UTSW 18 58,186,099 (GRCm39) missense probably benign 0.04
R7226:Fbn2 UTSW 18 58,170,142 (GRCm39) missense probably damaging 1.00
R7260:Fbn2 UTSW 18 58,199,188 (GRCm39) missense probably benign 0.14
R7414:Fbn2 UTSW 18 58,229,122 (GRCm39) missense probably damaging 1.00
R7485:Fbn2 UTSW 18 58,204,912 (GRCm39) missense possibly damaging 0.50
R7523:Fbn2 UTSW 18 58,199,152 (GRCm39) missense probably benign 0.01
R7549:Fbn2 UTSW 18 58,153,536 (GRCm39) nonsense probably null
R7619:Fbn2 UTSW 18 58,213,299 (GRCm39) missense possibly damaging 0.46
R7638:Fbn2 UTSW 18 58,238,208 (GRCm39) missense probably damaging 1.00
R7789:Fbn2 UTSW 18 58,172,385 (GRCm39) missense probably benign 0.22
R7932:Fbn2 UTSW 18 58,153,555 (GRCm39) missense possibly damaging 0.61
R8013:Fbn2 UTSW 18 58,237,153 (GRCm39) missense possibly damaging 0.62
R8076:Fbn2 UTSW 18 58,159,496 (GRCm39) nonsense probably null
R8300:Fbn2 UTSW 18 58,342,687 (GRCm39) missense probably benign
R8345:Fbn2 UTSW 18 58,191,503 (GRCm39) missense probably damaging 1.00
R8487:Fbn2 UTSW 18 58,153,462 (GRCm39) missense possibly damaging 0.53
R8520:Fbn2 UTSW 18 58,171,270 (GRCm39) critical splice donor site probably null
R8781:Fbn2 UTSW 18 58,194,719 (GRCm39) missense possibly damaging 0.88
R8801:Fbn2 UTSW 18 58,287,021 (GRCm39) missense probably damaging 1.00
R8857:Fbn2 UTSW 18 58,286,933 (GRCm39) missense probably damaging 1.00
R8878:Fbn2 UTSW 18 58,257,318 (GRCm39) missense probably benign 0.30
R8909:Fbn2 UTSW 18 58,192,508 (GRCm39) missense possibly damaging 0.88
R8973:Fbn2 UTSW 18 58,286,928 (GRCm39) missense probably damaging 1.00
R8975:Fbn2 UTSW 18 58,286,928 (GRCm39) missense probably damaging 1.00
R8979:Fbn2 UTSW 18 58,286,928 (GRCm39) missense probably damaging 1.00
R8991:Fbn2 UTSW 18 58,239,395 (GRCm39) missense probably damaging 1.00
R9003:Fbn2 UTSW 18 58,176,591 (GRCm39) missense probably damaging 1.00
R9205:Fbn2 UTSW 18 58,192,428 (GRCm39) missense probably damaging 1.00
R9215:Fbn2 UTSW 18 58,209,747 (GRCm39) missense probably damaging 1.00
R9263:Fbn2 UTSW 18 58,257,344 (GRCm39) missense probably damaging 1.00
R9307:Fbn2 UTSW 18 58,342,856 (GRCm39) missense probably benign
R9337:Fbn2 UTSW 18 58,342,723 (GRCm39) missense probably benign
R9403:Fbn2 UTSW 18 58,199,179 (GRCm39) missense probably damaging 1.00
R9501:Fbn2 UTSW 18 58,209,130 (GRCm39) missense probably damaging 1.00
R9503:Fbn2 UTSW 18 58,171,313 (GRCm39) missense probably damaging 1.00
R9509:Fbn2 UTSW 18 58,247,550 (GRCm39) missense probably benign 0.22
R9561:Fbn2 UTSW 18 58,181,611 (GRCm39) nonsense probably null
R9565:Fbn2 UTSW 18 58,228,298 (GRCm39) missense probably benign 0.20
R9652:Fbn2 UTSW 18 58,146,722 (GRCm39) critical splice donor site probably null
R9659:Fbn2 UTSW 18 58,342,654 (GRCm39) missense probably damaging 0.98
R9679:Fbn2 UTSW 18 58,201,433 (GRCm39) missense probably damaging 1.00
R9683:Fbn2 UTSW 18 58,186,099 (GRCm39) missense probably benign 0.04
R9773:Fbn2 UTSW 18 58,143,481 (GRCm39) missense probably benign
X0062:Fbn2 UTSW 18 58,189,285 (GRCm39) missense probably damaging 1.00
Z1177:Fbn2 UTSW 18 58,202,262 (GRCm39) missense probably damaging 1.00
Z1177:Fbn2 UTSW 18 58,188,554 (GRCm39) missense probably benign 0.00
Z1177:Fbn2 UTSW 18 58,143,451 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTAAGTCTTCCTGCCACCACTGAG -3'
(R):5'- AGGATCTATGTCCATACGGCCACG -3'

Sequencing Primer
(F):5'- ACCACTGAGGCTACCTGAG -3'
(R):5'- GGACAGTCCCTAGTCTTCATGAC -3'
Posted On 2013-07-11