Incidental Mutation 'R7755:Khnyn'
ID597521
Institutional Source Beutler Lab
Gene Symbol Khnyn
Ensembl Gene ENSMUSG00000047153
Gene NameKH and NYN domain containing
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R7755 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55884947-55898775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55887968 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 503 (T503A)
Ref Sequence ENSEMBL: ENSMUSP00000153796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022831] [ENSMUST00000063871] [ENSMUST00000172378] [ENSMUST00000228462]
Predicted Effect probably damaging
Transcript: ENSMUST00000022831
AA Change: T503A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022831
Gene: ENSMUSG00000047153
AA Change: T503A

DomainStartEndE-ValueType
low complexity region 350 365 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
Pfam:RNase_Zc3h12a 429 582 1.9e-66 PFAM
low complexity region 623 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063871
SMART Domains Protein: ENSMUSP00000070494
Gene: ENSMUSG00000040380

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
C1Q 57 197 6.3e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172378
SMART Domains Protein: ENSMUSP00000127798
Gene: ENSMUSG00000040380

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
C1Q 57 197 6.3e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227462
Predicted Effect probably damaging
Transcript: ENSMUST00000228462
AA Change: T503A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8704 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: This gene encodes a protein with a C-terminal RNA modifying domain that belongs to a family of ribonucleases typified by eukaryotic Nedd4-binding protein1 and the bacterial YacP-like nucleases (NYN). The NYN domain shares a common protein fold with two other groups of nucleases, the PilT N-terminal nuclease and FLAP nuclease superfamilies. In addition to the NYN domain, the protein encoded by this gene also contains an N-terminal K homology RNA-binding domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,189,413 M1179I probably benign Het
4930402F06Rik T C 2: 35,376,337 Y107C probably damaging Het
Aff4 T C 11: 53,398,379 S452P probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
Begain A G 12: 109,052,876 L215P probably benign Het
Carf T A 1: 60,148,055 S606T probably benign Het
Cngb3 A T 4: 19,461,684 T522S probably benign Het
Ctsll3 A T 13: 60,800,405 F153I probably damaging Het
Cubn G A 2: 13,280,078 T3509I probably benign Het
Dmrta1 T C 4: 89,691,933 S377P probably benign Het
Dnmbp G A 19: 43,850,086 A659V probably benign Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Dync2h1 T C 9: 7,015,490 D3598G probably benign Het
Fam35a T C 14: 34,248,890 K627E probably damaging Het
Flot2 T C 11: 78,049,513 F29L probably benign Het
Hectd1 A T 12: 51,802,220 I367K possibly damaging Het
Ikbkap T C 4: 56,774,552 N779S possibly damaging Het
Ivl T A 3: 92,572,010 K249N probably damaging Het
Kdelc1 T C 1: 44,118,573 probably benign Het
Mbd4 T A 6: 115,844,585 I490F probably damaging Het
Mlip T C 9: 77,229,556 T690A probably benign Het
Mmp1a T A 9: 7,467,004 D227E possibly damaging Het
Mrgprf T C 7: 145,308,643 L314P probably damaging Het
Ndufb9 T G 15: 58,936,406 Y80* probably null Het
Neto2 C T 8: 85,669,656 R155H probably damaging Het
Npat T A 9: 53,559,170 N365K possibly damaging Het
Nsl1 G A 1: 191,063,183 V49M probably benign Het
Nudt21 T A 8: 94,022,865 Y191F probably benign Het
Olfr225 A G 11: 59,613,641 R226G probably damaging Het
Olfr921 T G 9: 38,775,777 I174S possibly damaging Het
Pcdh18 T C 3: 49,754,829 Y679C possibly damaging Het
Pkd1l3 A G 8: 109,630,166 D741G possibly damaging Het
Pkhd1 T C 1: 20,547,493 D956G probably damaging Het
Pparg C T 6: 115,463,106 P214S probably damaging Het
Ppargc1a T A 5: 51,473,541 Y582F unknown Het
Prdm9 C T 17: 15,544,964 C518Y probably damaging Het
Rangrf T A 11: 68,973,714 E2V probably damaging Het
Rpl19 T C 11: 98,028,367 I45T probably benign Het
Rtn4rl2 T C 2: 84,872,463 D255G possibly damaging Het
Sirt3 T C 7: 140,878,050 D62G Het
Slc22a30 T C 19: 8,336,769 T518A probably damaging Het
Slc40a1 T C 1: 45,911,306 T329A probably damaging Het
Slc6a17 C T 3: 107,474,355 G470D probably damaging Het
Syne2 A T 12: 75,997,407 I3923L probably benign Het
Tiam2 C T 17: 3,421,316 S411L probably benign Het
Ticam1 A G 17: 56,270,182 C638R unknown Het
Tnrc6c A G 11: 117,758,086 T1528A probably benign Het
Ufl1 A G 4: 25,262,274 I404T probably benign Het
Usp43 A T 11: 67,891,468 S375T possibly damaging Het
Vmn2r88 C G 14: 51,413,046 A72G probably benign Het
Vmn2r91 A T 17: 18,110,049 I532F possibly damaging Het
Vmn2r95 T C 17: 18,424,105 M1T probably null Het
Xirp2 T C 2: 67,515,182 V2589A probably benign Het
Zfp128 C T 7: 12,890,313 Q203* probably null Het
Other mutations in Khnyn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01746:Khnyn APN 14 55886982 missense probably benign 0.02
IGL01924:Khnyn APN 14 55894969 missense probably benign 0.03
IGL01990:Khnyn APN 14 55887588 missense possibly damaging 0.87
R0310:Khnyn UTSW 14 55887968 missense probably damaging 1.00
R1822:Khnyn UTSW 14 55885852 missense probably damaging 1.00
R2248:Khnyn UTSW 14 55886738 missense probably benign 0.30
R4333:Khnyn UTSW 14 55894042 missense probably damaging 1.00
R4334:Khnyn UTSW 14 55894042 missense probably damaging 1.00
R4600:Khnyn UTSW 14 55886981 missense probably benign 0.02
R4731:Khnyn UTSW 14 55886489 splice site probably null
R4732:Khnyn UTSW 14 55886489 splice site probably null
R4733:Khnyn UTSW 14 55886489 splice site probably null
R5063:Khnyn UTSW 14 55887203 nonsense probably null
R5434:Khnyn UTSW 14 55887500 missense probably damaging 1.00
R5908:Khnyn UTSW 14 55887066 missense probably benign
R5928:Khnyn UTSW 14 55885887 missense probably damaging 1.00
R6144:Khnyn UTSW 14 55887839 missense probably damaging 0.98
R6147:Khnyn UTSW 14 55887603 missense probably damaging 1.00
R6353:Khnyn UTSW 14 55894303 missense possibly damaging 0.89
R7179:Khnyn UTSW 14 55894354 missense probably damaging 1.00
R7658:Khnyn UTSW 14 55887139 nonsense probably null
R7831:Khnyn UTSW 14 55887846 critical splice donor site probably null
R7947:Khnyn UTSW 14 55887602 missense probably damaging 1.00
R8006:Khnyn UTSW 14 55887590 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GGGTATTGCTCTCGCTGTAC -3'
(R):5'- CATTTGTCCCACTGAAACTAGCTC -3'

Sequencing Primer
(F):5'- ACCGTGACATAACCGTCTTTGTG -3'
(R):5'- CTAGCTCTACTACTGAGGCTAGAAG -3'
Posted On2019-11-26