Incidental Mutation 'R7756:Pls1'
ID597560
Institutional Source Beutler Lab
Gene Symbol Pls1
Ensembl Gene ENSMUSG00000049493
Gene Nameplastin 1 (I-isoform)
SynonymsI-fimbrin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R7756 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location95752642-95845311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95776844 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 197 (N197S)
Ref Sequence ENSEMBL: ENSMUSP00000091317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093800]
Predicted Effect probably benign
Transcript: ENSMUST00000093800
AA Change: N197S

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091317
Gene: ENSMUSG00000049493
AA Change: N197S

DomainStartEndE-ValueType
EFh 15 43 8.5e-5 SMART
EFh 55 83 1.73e-5 SMART
low complexity region 100 116 N/A INTRINSIC
CH 124 236 3.69e-23 SMART
CH 268 375 4.4e-21 SMART
CH 398 503 7.27e-22 SMART
CH 519 624 3.75e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. The protein encoded by this gene is a third distinct plastin isoform, which is specifically expressed at high levels in the small intestine. Alternatively spliced transcript variants varying in the 5' UTR, but encoding the same protein, have been found for this gene. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous inactivation for this gene leads to altered intestinal morphology and physiology, increased brush border fragility and susceptibility to induced colitis, as well as a moderate and progressive form of hearing loss associated with defects in stereocilia morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik A G 1: 136,216,433 S422P probably benign Het
Ankrd60 T C 2: 173,568,769 *319W probably null Het
Brd4 A G 17: 32,198,982 I1157T unknown Het
Btbd2 T C 10: 80,648,606 I159V probably benign Het
Card6 G A 15: 5,099,896 Q673* probably null Het
Cdyl T A 13: 35,872,641 Y585N probably damaging Het
Cep192 A C 18: 67,856,313 I1844L possibly damaging Het
Cfap99 G T 5: 34,302,608 C105F probably damaging Het
Clcn6 T C 4: 148,029,439 D54G probably damaging Het
Dennd5a T C 7: 109,921,507 N381S possibly damaging Het
Disp1 A C 1: 183,089,734 V374G probably damaging Het
Dock4 C T 12: 40,710,879 T522I probably benign Het
Fcer1a A G 1: 173,221,575 L223P probably damaging Het
Fstl4 C A 11: 53,168,296 D527E possibly damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm5460 A T 14: 34,035,157 T64S probably benign Het
Gys1 T C 7: 45,448,302 V491A probably benign Het
Hoxa9 A T 6: 52,225,562 N181K probably benign Het
Ift81 A T 5: 122,551,025 L676H probably damaging Het
Impad1 A T 4: 4,769,385 H243Q probably damaging Het
Itga1 T A 13: 114,992,460 D554V probably benign Het
Lin7c T A 2: 109,896,372 I122K probably damaging Het
Malt1 A G 18: 65,473,119 I622V probably benign Het
Megf8 T C 7: 25,342,425 probably null Het
Morc2b A G 17: 33,137,007 V597A probably damaging Het
Nr1h5 T C 3: 102,949,609 I196V probably benign Het
Olfr229 T G 9: 39,910,325 I174S possibly damaging Het
Olfr434 T A 6: 43,217,016 Y34* probably null Het
Olfr963 T C 9: 39,669,075 M6T probably benign Het
Pdlim1 G A 19: 40,243,542 P131S probably benign Het
Plekhh1 T C 12: 79,070,804 I858T probably benign Het
Pnmal1 A T 7: 16,961,299 T360S probably benign Het
Pon1 A T 6: 5,168,344 D354E probably benign Het
Rbp3 G A 14: 33,954,775 V227M probably benign Het
Shcbp1 T C 8: 4,744,545 K416R probably damaging Het
Slc20a2 T G 8: 22,535,492 I70S probably damaging Het
Slc7a11 A G 3: 50,372,360 I484T probably benign Het
Snrpa A G 7: 27,192,946 V63A possibly damaging Het
Stat2 CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC 10: 128,290,728 probably benign Het
Strc T C 2: 121,370,946 E1259G probably benign Het
Suds3 T G 5: 117,115,737 D26A unknown Het
Tnrc18 A G 5: 142,787,152 S641P Het
Tspan32 A G 7: 143,017,222 N189D probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Usp40 G T 1: 87,967,200 T866K probably damaging Het
Vmn1r220 G A 13: 23,183,707 T273I probably benign Het
Yes1 C T 5: 32,684,680 T516I probably damaging Het
Zbtb4 A G 11: 69,778,542 E697G probably benign Het
Zfp994 T C 17: 22,200,847 T374A possibly damaging Het
Other mutations in Pls1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pls1 APN 9 95782419 missense possibly damaging 0.95
IGL00836:Pls1 APN 9 95761422 missense possibly damaging 0.86
IGL01391:Pls1 APN 9 95773698 missense probably benign 0.38
IGL02335:Pls1 APN 9 95784183 missense probably benign 0.32
IGL02875:Pls1 APN 9 95754351 missense possibly damaging 0.93
IGL03081:Pls1 APN 9 95773643 missense probably damaging 1.00
IGL03271:Pls1 APN 9 95776830 missense probably benign 0.04
PIT4585001:Pls1 UTSW 9 95761390 missense probably benign
R0048:Pls1 UTSW 9 95787063 missense probably damaging 1.00
R0088:Pls1 UTSW 9 95795768 missense possibly damaging 0.93
R0409:Pls1 UTSW 9 95786919 splice site probably benign
R2015:Pls1 UTSW 9 95761365 missense possibly damaging 0.77
R2516:Pls1 UTSW 9 95776563 missense probably benign 0.00
R2985:Pls1 UTSW 9 95785582 missense possibly damaging 0.73
R3964:Pls1 UTSW 9 95785612 missense probably benign 0.00
R3965:Pls1 UTSW 9 95785612 missense probably benign 0.00
R5240:Pls1 UTSW 9 95776622 splice site probably null
R5681:Pls1 UTSW 9 95787012 missense probably damaging 1.00
R6399:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6441:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6496:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6498:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6499:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R7016:Pls1 UTSW 9 95786941 missense probably damaging 1.00
R7177:Pls1 UTSW 9 95773559 missense probably benign 0.01
R7458:Pls1 UTSW 9 95785507 missense probably damaging 1.00
R7467:Pls1 UTSW 9 95769113 missense possibly damaging 0.78
R7536:Pls1 UTSW 9 95762057 missense probably damaging 1.00
R7553:Pls1 UTSW 9 95787087 missense probably damaging 1.00
R7691:Pls1 UTSW 9 95773673 missense probably benign 0.21
R7758:Pls1 UTSW 9 95776844 missense probably benign 0.44
R7876:Pls1 UTSW 9 95785505 nonsense probably null
R8269:Pls1 UTSW 9 95761970 missense probably damaging 1.00
R8380:Pls1 UTSW 9 95775385 missense probably benign 0.03
Z1177:Pls1 UTSW 9 95754387 missense probably damaging 0.99
Z1177:Pls1 UTSW 9 95785618 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GAGGTAAGCTCTTCCTTCGTG -3'
(R):5'- TTGCCCTGTGTACATGACAG -3'

Sequencing Primer
(F):5'- TCCTTCAGCTGCAATGGG -3'
(R):5'- CCCTGTGTACATGACAGTTGAAGC -3'
Posted On2019-11-26