Incidental Mutation 'R7756:Fstl4'
ID597563
Institutional Source Beutler Lab
Gene Symbol Fstl4
Ensembl Gene ENSMUSG00000036264
Gene Namefollistatin-like 4
SynonymsSPIG1, B230374F23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R7756 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location52764634-53188538 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 53168296 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 527 (D527E)
Ref Sequence ENSEMBL: ENSMUSP00000042007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036796]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036796
AA Change: D527E

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000042007
Gene: ENSMUSG00000036264
AA Change: D527E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
KAZAL 87 132 4.7e-13 SMART
Blast:IG_like 215 241 6e-7 BLAST
IGc2 260 327 1.9e-6 SMART
IGc2 352 419 1e-14 SMART
Meta Mutation Damage Score 0.1962 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Homozygous null mice were born at expected Mendelian ratio and healthy, fertile, apparently normal with normal retinal laminar structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik A G 1: 136,216,433 S422P probably benign Het
Ankrd60 T C 2: 173,568,769 *319W probably null Het
Brd4 A G 17: 32,198,982 I1157T unknown Het
Btbd2 T C 10: 80,648,606 I159V probably benign Het
Card6 G A 15: 5,099,896 Q673* probably null Het
Cdyl T A 13: 35,872,641 Y585N probably damaging Het
Cep192 A C 18: 67,856,313 I1844L possibly damaging Het
Cfap99 G T 5: 34,302,608 C105F probably damaging Het
Clcn6 T C 4: 148,029,439 D54G probably damaging Het
Dennd5a T C 7: 109,921,507 N381S possibly damaging Het
Disp1 A C 1: 183,089,734 V374G probably damaging Het
Dock4 C T 12: 40,710,879 T522I probably benign Het
Fcer1a A G 1: 173,221,575 L223P probably damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm5460 A T 14: 34,035,157 T64S probably benign Het
Gys1 T C 7: 45,448,302 V491A probably benign Het
Hoxa9 A T 6: 52,225,562 N181K probably benign Het
Ift81 A T 5: 122,551,025 L676H probably damaging Het
Impad1 A T 4: 4,769,385 H243Q probably damaging Het
Itga1 T A 13: 114,992,460 D554V probably benign Het
Lin7c T A 2: 109,896,372 I122K probably damaging Het
Malt1 A G 18: 65,473,119 I622V probably benign Het
Megf8 T C 7: 25,342,425 probably null Het
Morc2b A G 17: 33,137,007 V597A probably damaging Het
Nr1h5 T C 3: 102,949,609 I196V probably benign Het
Olfr229 T G 9: 39,910,325 I174S possibly damaging Het
Olfr434 T A 6: 43,217,016 Y34* probably null Het
Olfr963 T C 9: 39,669,075 M6T probably benign Het
Pdlim1 G A 19: 40,243,542 P131S probably benign Het
Plekhh1 T C 12: 79,070,804 I858T probably benign Het
Pls1 T C 9: 95,776,844 N197S probably benign Het
Pnmal1 A T 7: 16,961,299 T360S probably benign Het
Pon1 A T 6: 5,168,344 D354E probably benign Het
Rbp3 G A 14: 33,954,775 V227M probably benign Het
Shcbp1 T C 8: 4,744,545 K416R probably damaging Het
Slc20a2 T G 8: 22,535,492 I70S probably damaging Het
Slc7a11 A G 3: 50,372,360 I484T probably benign Het
Snrpa A G 7: 27,192,946 V63A possibly damaging Het
Stat2 CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC 10: 128,290,728 probably benign Het
Strc T C 2: 121,370,946 E1259G probably benign Het
Suds3 T G 5: 117,115,737 D26A unknown Het
Tnrc18 A G 5: 142,787,152 S641P Het
Tspan32 A G 7: 143,017,222 N189D probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Usp40 G T 1: 87,967,200 T866K probably damaging Het
Vmn1r220 G A 13: 23,183,707 T273I probably benign Het
Yes1 C T 5: 32,684,680 T516I probably damaging Het
Zbtb4 A G 11: 69,778,542 E697G probably benign Het
Zfp994 T C 17: 22,200,847 T374A possibly damaging Het
Other mutations in Fstl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Fstl4 APN 11 53186275 missense probably benign 0.01
IGL00885:Fstl4 APN 11 53148982 missense possibly damaging 0.90
IGL00915:Fstl4 APN 11 53176998 missense probably benign
IGL00933:Fstl4 APN 11 53186761 missense possibly damaging 0.80
IGL01022:Fstl4 APN 11 53186741 missense probably benign 0.18
IGL01121:Fstl4 APN 11 52814637 missense probably benign 0.00
IGL01656:Fstl4 APN 11 53000374 missense probably damaging 1.00
IGL01805:Fstl4 APN 11 53186357 missense probably damaging 1.00
IGL01997:Fstl4 APN 11 53163054 nonsense probably null
IGL02386:Fstl4 APN 11 52773871 missense probably benign 0.21
IGL02536:Fstl4 APN 11 53134024 splice site probably benign
IGL02807:Fstl4 APN 11 53186674 missense probably benign 0.03
IGL03037:Fstl4 APN 11 53168223 missense possibly damaging 0.83
R0462:Fstl4 UTSW 11 53186402 missense probably benign 0.09
R1190:Fstl4 UTSW 11 53068546 missense probably benign
R1300:Fstl4 UTSW 11 53068627 missense probably benign
R1626:Fstl4 UTSW 11 53000290 nonsense probably null
R1695:Fstl4 UTSW 11 53165878 splice site probably null
R1699:Fstl4 UTSW 11 53168178 missense possibly damaging 0.81
R1727:Fstl4 UTSW 11 53068651 missense probably damaging 1.00
R1752:Fstl4 UTSW 11 53186795 missense probably benign 0.09
R1866:Fstl4 UTSW 11 53186398 missense probably benign 0.00
R4689:Fstl4 UTSW 11 53068650 nonsense probably null
R5126:Fstl4 UTSW 11 53186561 missense possibly damaging 0.71
R5129:Fstl4 UTSW 11 53186439 missense probably damaging 1.00
R5499:Fstl4 UTSW 11 53068547 missense probably benign 0.01
R5578:Fstl4 UTSW 11 53165781 missense probably damaging 1.00
R5715:Fstl4 UTSW 11 53000416 missense possibly damaging 0.53
R6125:Fstl4 UTSW 11 53186303 missense probably benign
R6177:Fstl4 UTSW 11 53168204 missense probably benign 0.00
R6236:Fstl4 UTSW 11 53186335 missense probably benign 0.00
R6311:Fstl4 UTSW 11 53176977 missense probably damaging 1.00
R6611:Fstl4 UTSW 11 53186725 missense probably benign 0.01
R6886:Fstl4 UTSW 11 53186450 missense probably damaging 1.00
R7404:Fstl4 UTSW 11 53134071 missense probably benign 0.03
R7423:Fstl4 UTSW 11 53068555 missense possibly damaging 0.54
R7586:Fstl4 UTSW 11 53072429 missense probably benign 0.00
R7758:Fstl4 UTSW 11 53168296 missense possibly damaging 0.69
R7775:Fstl4 UTSW 11 53176971 nonsense probably null
R7953:Fstl4 UTSW 11 53000223 missense probably benign 0.01
R8026:Fstl4 UTSW 11 53068669 missense probably damaging 0.99
R8043:Fstl4 UTSW 11 53000223 missense probably benign 0.01
R8375:Fstl4 UTSW 11 53162675 missense possibly damaging 0.63
R8866:Fstl4 UTSW 11 53072406 missense possibly damaging 0.54
X0013:Fstl4 UTSW 11 53162619 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGGGATGTTTGAGTAGG -3'
(R):5'- AAGTCTCCTTTGGCTAAGCTC -3'

Sequencing Primer
(F):5'- TTTGAGTAGGGTTGAAGAACAGATAC -3'
(R):5'- TCACTTTGAAGACCAGGCTG -3'
Posted On2019-11-26