Incidental Mutation 'R7756:Cdyl'
ID597568
Institutional Source Beutler Lab
Gene Symbol Cdyl
Ensembl Gene ENSMUSG00000059288
Gene Namechromodomain protein, Y chromosome-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock #R7756 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location35659833-35874063 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35872641 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 585 (Y585N)
Ref Sequence ENSEMBL: ENSMUSP00000074707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075220] [ENSMUST00000163595]
Predicted Effect probably damaging
Transcript: ENSMUST00000075220
AA Change: Y585N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074707
Gene: ENSMUSG00000059288
AA Change: Y585N

DomainStartEndE-ValueType
CHROMO 55 109 2.06e-18 SMART
low complexity region 116 129 N/A INTRINSIC
Pfam:ECH_1 342 593 1.8e-35 PFAM
Pfam:ECH_2 348 592 6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163595
AA Change: Y536N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131784
Gene: ENSMUSG00000059288
AA Change: Y536N

DomainStartEndE-ValueType
CHROMO 6 60 1.58e-19 SMART
low complexity region 67 80 N/A INTRINSIC
Pfam:ECH 291 539 4e-38 PFAM
Meta Mutation Damage Score 0.9536 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chromodomain Y is a primate-specific Y-chromosomal gene family expressed exclusively in the testis and implicated in infertility. Although the Y-linked genes are testis-specific, this autosomal gene is ubiquitously expressed. The Y-linked genes arose by retrotransposition of an mRNA from this gene, followed by amplification of the retroposed gene. Proteins encoded by this gene superfamily possess a chromodomain, a motif implicated in chromatin binding and gene suppression, and a catalytic domain believed to be involved in histone acetylation. Multiple proteins are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Conditional homozygous knockout in the cerebral cortex affects neuronal migration and results in increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik A G 1: 136,216,433 S422P probably benign Het
Ankrd60 T C 2: 173,568,769 *319W probably null Het
Brd4 A G 17: 32,198,982 I1157T unknown Het
Btbd2 T C 10: 80,648,606 I159V probably benign Het
Card6 G A 15: 5,099,896 Q673* probably null Het
Cep192 A C 18: 67,856,313 I1844L possibly damaging Het
Cfap99 G T 5: 34,302,608 C105F probably damaging Het
Clcn6 T C 4: 148,029,439 D54G probably damaging Het
Dennd5a T C 7: 109,921,507 N381S possibly damaging Het
Disp1 A C 1: 183,089,734 V374G probably damaging Het
Dock4 C T 12: 40,710,879 T522I probably benign Het
Fcer1a A G 1: 173,221,575 L223P probably damaging Het
Fstl4 C A 11: 53,168,296 D527E possibly damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm5460 A T 14: 34,035,157 T64S probably benign Het
Gys1 T C 7: 45,448,302 V491A probably benign Het
Hoxa9 A T 6: 52,225,562 N181K probably benign Het
Ift81 A T 5: 122,551,025 L676H probably damaging Het
Impad1 A T 4: 4,769,385 H243Q probably damaging Het
Itga1 T A 13: 114,992,460 D554V probably benign Het
Lin7c T A 2: 109,896,372 I122K probably damaging Het
Malt1 A G 18: 65,473,119 I622V probably benign Het
Megf8 T C 7: 25,342,425 probably null Het
Morc2b A G 17: 33,137,007 V597A probably damaging Het
Nr1h5 T C 3: 102,949,609 I196V probably benign Het
Olfr229 T G 9: 39,910,325 I174S possibly damaging Het
Olfr434 T A 6: 43,217,016 Y34* probably null Het
Olfr963 T C 9: 39,669,075 M6T probably benign Het
Pdlim1 G A 19: 40,243,542 P131S probably benign Het
Plekhh1 T C 12: 79,070,804 I858T probably benign Het
Pls1 T C 9: 95,776,844 N197S probably benign Het
Pnmal1 A T 7: 16,961,299 T360S probably benign Het
Pon1 A T 6: 5,168,344 D354E probably benign Het
Rbp3 G A 14: 33,954,775 V227M probably benign Het
Shcbp1 T C 8: 4,744,545 K416R probably damaging Het
Slc20a2 T G 8: 22,535,492 I70S probably damaging Het
Slc7a11 A G 3: 50,372,360 I484T probably benign Het
Snrpa A G 7: 27,192,946 V63A possibly damaging Het
Stat2 CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC 10: 128,290,728 probably benign Het
Strc T C 2: 121,370,946 E1259G probably benign Het
Suds3 T G 5: 117,115,737 D26A unknown Het
Tnrc18 A G 5: 142,787,152 S641P Het
Tspan32 A G 7: 143,017,222 N189D probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Usp40 G T 1: 87,967,200 T866K probably damaging Het
Vmn1r220 G A 13: 23,183,707 T273I probably benign Het
Yes1 C T 5: 32,684,680 T516I probably damaging Het
Zbtb4 A G 11: 69,778,542 E697G probably benign Het
Zfp994 T C 17: 22,200,847 T374A possibly damaging Het
Other mutations in Cdyl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Cdyl APN 13 35816113 missense probably damaging 0.98
IGL01547:Cdyl APN 13 35790162 missense possibly damaging 0.90
IGL01911:Cdyl APN 13 35863243 missense probably damaging 0.97
IGL02584:Cdyl APN 13 35683786 missense probably benign
IGL02754:Cdyl APN 13 35683742 splice site probably benign
R1630:Cdyl UTSW 13 35683803 missense possibly damaging 0.66
R1678:Cdyl UTSW 13 35856889 missense probably damaging 0.99
R1802:Cdyl UTSW 13 35872636 nonsense probably null
R4435:Cdyl UTSW 13 35858250 critical splice donor site probably null
R5841:Cdyl UTSW 13 35872561 missense probably damaging 1.00
R5860:Cdyl UTSW 13 35858083 missense possibly damaging 0.73
R6430:Cdyl UTSW 13 35871606 missense possibly damaging 0.74
R7127:Cdyl UTSW 13 35856668 missense probably benign 0.01
R7296:Cdyl UTSW 13 35863395 missense probably damaging 1.00
R7369:Cdyl UTSW 13 35816009 missense probably damaging 1.00
R7422:Cdyl UTSW 13 35858194 missense possibly damaging 0.90
R7635:Cdyl UTSW 13 35871651 missense probably damaging 1.00
R7758:Cdyl UTSW 13 35872641 missense probably damaging 1.00
R7764:Cdyl UTSW 13 35816143 missense possibly damaging 0.92
R8221:Cdyl UTSW 13 35816164 missense probably benign 0.00
R8820:Cdyl UTSW 13 35858191 missense probably damaging 1.00
Z1176:Cdyl UTSW 13 35815966 missense probably damaging 1.00
Z1177:Cdyl UTSW 13 35816070 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TAGTGCCTATAGACAGCCGTCC -3'
(R):5'- TTCCAAGAGCAGCCTAGTGC -3'

Sequencing Primer
(F):5'- TATAGACAGCCGTCCCCTGAC -3'
(R):5'- TAAAGACGCTTAGACAAAGAAGC -3'
Posted On2019-11-26