Incidental Mutation 'R7756:Itga1'
ID597569
Institutional Source Beutler Lab
Gene Symbol Itga1
Ensembl Gene ENSMUSG00000042284
Gene Nameintegrin alpha 1
SynonymsCD49A, Vla1, E130012M19Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.544) question?
Stock #R7756 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location114953096-115101964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 114992460 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 554 (D554V)
Ref Sequence ENSEMBL: ENSMUSP00000077132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061673]
Predicted Effect probably benign
Transcript: ENSMUST00000061673
AA Change: D554V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284
AA Change: D554V

DomainStartEndE-ValueType
Int_alpha 43 96 1.63e0 SMART
VWA 170 360 4.24e-44 SMART
Int_alpha 432 481 4.21e-3 SMART
Int_alpha 485 542 3.19e-12 SMART
Int_alpha 566 621 1.79e-15 SMART
Int_alpha 628 682 3.04e1 SMART
low complexity region 1108 1122 N/A INTRINSIC
PDB:2L8S|A 1135 1179 5e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224865
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal although their kidneys are smaller and more succeptible to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik A G 1: 136,216,433 S422P probably benign Het
Ankrd60 T C 2: 173,568,769 *319W probably null Het
Brd4 A G 17: 32,198,982 I1157T unknown Het
Btbd2 T C 10: 80,648,606 I159V probably benign Het
Card6 G A 15: 5,099,896 Q673* probably null Het
Cdyl T A 13: 35,872,641 Y585N probably damaging Het
Cep192 A C 18: 67,856,313 I1844L possibly damaging Het
Cfap99 G T 5: 34,302,608 C105F probably damaging Het
Clcn6 T C 4: 148,029,439 D54G probably damaging Het
Dennd5a T C 7: 109,921,507 N381S possibly damaging Het
Disp1 A C 1: 183,089,734 V374G probably damaging Het
Dock4 C T 12: 40,710,879 T522I probably benign Het
Fcer1a A G 1: 173,221,575 L223P probably damaging Het
Fstl4 C A 11: 53,168,296 D527E possibly damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm5460 A T 14: 34,035,157 T64S probably benign Het
Gys1 T C 7: 45,448,302 V491A probably benign Het
Hoxa9 A T 6: 52,225,562 N181K probably benign Het
Ift81 A T 5: 122,551,025 L676H probably damaging Het
Impad1 A T 4: 4,769,385 H243Q probably damaging Het
Lin7c T A 2: 109,896,372 I122K probably damaging Het
Malt1 A G 18: 65,473,119 I622V probably benign Het
Megf8 T C 7: 25,342,425 probably null Het
Morc2b A G 17: 33,137,007 V597A probably damaging Het
Nr1h5 T C 3: 102,949,609 I196V probably benign Het
Olfr229 T G 9: 39,910,325 I174S possibly damaging Het
Olfr434 T A 6: 43,217,016 Y34* probably null Het
Olfr963 T C 9: 39,669,075 M6T probably benign Het
Pdlim1 G A 19: 40,243,542 P131S probably benign Het
Plekhh1 T C 12: 79,070,804 I858T probably benign Het
Pls1 T C 9: 95,776,844 N197S probably benign Het
Pnmal1 A T 7: 16,961,299 T360S probably benign Het
Pon1 A T 6: 5,168,344 D354E probably benign Het
Rbp3 G A 14: 33,954,775 V227M probably benign Het
Shcbp1 T C 8: 4,744,545 K416R probably damaging Het
Slc20a2 T G 8: 22,535,492 I70S probably damaging Het
Slc7a11 A G 3: 50,372,360 I484T probably benign Het
Snrpa A G 7: 27,192,946 V63A possibly damaging Het
Stat2 CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC 10: 128,290,728 probably benign Het
Strc T C 2: 121,370,946 E1259G probably benign Het
Suds3 T G 5: 117,115,737 D26A unknown Het
Tnrc18 A G 5: 142,787,152 S641P Het
Tspan32 A G 7: 143,017,222 N189D probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Usp40 G T 1: 87,967,200 T866K probably damaging Het
Vmn1r220 G A 13: 23,183,707 T273I probably benign Het
Yes1 C T 5: 32,684,680 T516I probably damaging Het
Zbtb4 A G 11: 69,778,542 E697G probably benign Het
Zfp994 T C 17: 22,200,847 T374A possibly damaging Het
Other mutations in Itga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Itga1 APN 13 114992363 missense possibly damaging 0.80
IGL00498:Itga1 APN 13 115031193 missense probably benign 0.00
IGL00549:Itga1 APN 13 115049296 missense possibly damaging 0.92
IGL00587:Itga1 APN 13 115012249 missense probably damaging 1.00
IGL01021:Itga1 APN 13 114997000 missense probably benign 0.29
IGL01289:Itga1 APN 13 114986226 missense possibly damaging 0.79
IGL01636:Itga1 APN 13 115006948 missense possibly damaging 0.73
IGL01791:Itga1 APN 13 114987661 missense probably benign 0.00
IGL01796:Itga1 APN 13 114985121 missense probably damaging 1.00
IGL02027:Itga1 APN 13 114990055 splice site probably null
IGL02330:Itga1 APN 13 115012204 missense probably damaging 1.00
IGL02480:Itga1 APN 13 114987648 missense probably damaging 1.00
IGL02943:Itga1 APN 13 115049296 missense possibly damaging 0.92
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0244:Itga1 UTSW 13 115006897 splice site probably benign
R0265:Itga1 UTSW 13 114992459 missense probably benign
R0302:Itga1 UTSW 13 115012318 splice site probably benign
R0320:Itga1 UTSW 13 114977594 splice site probably benign
R0389:Itga1 UTSW 13 114992460 missense probably benign 0.04
R0443:Itga1 UTSW 13 114992460 missense probably benign 0.04
R0574:Itga1 UTSW 13 114966561 missense probably damaging 1.00
R0646:Itga1 UTSW 13 114968299 missense probably benign
R0830:Itga1 UTSW 13 115007032 missense probably benign 0.08
R2162:Itga1 UTSW 13 115030910 missense probably benign 0.23
R2216:Itga1 UTSW 13 114997029 missense probably benign 0.00
R2403:Itga1 UTSW 13 114977614 missense probably benign 0.00
R3734:Itga1 UTSW 13 114977639 missense probably benign
R4171:Itga1 UTSW 13 115030886 nonsense probably null
R4402:Itga1 UTSW 13 115001566 missense probably benign 0.00
R4675:Itga1 UTSW 13 115001691 splice site probably null
R4684:Itga1 UTSW 13 115049370 missense probably damaging 1.00
R4795:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4796:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4845:Itga1 UTSW 13 114974172 nonsense probably null
R5147:Itga1 UTSW 13 114985142 missense possibly damaging 0.91
R5155:Itga1 UTSW 13 115035303 missense probably benign
R5234:Itga1 UTSW 13 115049303 nonsense probably null
R5344:Itga1 UTSW 13 115002309 missense possibly damaging 0.78
R5554:Itga1 UTSW 13 114992474 nonsense probably null
R5662:Itga1 UTSW 13 114986171 missense probably benign 0.03
R5945:Itga1 UTSW 13 114966590 missense probably benign 0.02
R6150:Itga1 UTSW 13 114968233 missense probably benign 0.01
R6241:Itga1 UTSW 13 114960137 splice site probably null
R6276:Itga1 UTSW 13 114980852 missense probably benign
R6369:Itga1 UTSW 13 114965660 missense probably damaging 1.00
R6511:Itga1 UTSW 13 114992501 missense probably damaging 0.98
R6663:Itga1 UTSW 13 114974105 missense probably benign 0.02
R6783:Itga1 UTSW 13 114996977 missense probably benign 0.22
R6931:Itga1 UTSW 13 115001563 missense probably benign 0.39
R7069:Itga1 UTSW 13 114968240 missense probably damaging 1.00
R7458:Itga1 UTSW 13 114986266 missense probably benign 0.00
R7588:Itga1 UTSW 13 114968249 missense possibly damaging 0.88
R7591:Itga1 UTSW 13 114982779 missense probably damaging 1.00
R7597:Itga1 UTSW 13 114974140 missense probably benign 0.28
R7615:Itga1 UTSW 13 114996922 missense probably null 0.99
R7795:Itga1 UTSW 13 115012236 missense probably damaging 1.00
R7819:Itga1 UTSW 13 115049301 missense probably damaging 0.99
Z1177:Itga1 UTSW 13 114985071 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTTGCCACTGCCATGATAAATG -3'
(R):5'- CCGAGGTTCCTTTGGCATTC -3'

Sequencing Primer
(F):5'- GATAAATGTACACAGCTCCTGCGTG -3'
(R):5'- TCATGTATCTTACAGGTCTGCTG -3'
Posted On2019-11-26