Incidental Mutation 'R7756:Malt1'
ID597576
Institutional Source Beutler Lab
Gene Symbol Malt1
Ensembl Gene ENSMUSG00000032688
Gene NameMALT1 paracaspase
Synonymsparacaspase, D430033E09Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172833

Is this an essential gene? Possibly non essential (E-score: 0.391) question?
Stock #R7756 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location65430962-65478823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65473119 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 622 (I622V)
Ref Sequence ENSEMBL: ENSMUSP00000048376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049248] [ENSMUST00000224056]
Predicted Effect probably benign
Transcript: ENSMUST00000049248
AA Change: I622V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000048376
Gene: ENSMUSG00000032688
AA Change: I622V

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 38 51 N/A INTRINSIC
PDB:2G7R|B 52 132 3e-29 PDB
IGc2 145 203 8.19e-9 SMART
IGc2 248 306 2.88e-4 SMART
Pfam:Peptidase_C14 340 557 1.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224056
AA Change: I633V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0693 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been found to be recurrently rearranged in chromosomal translocation with two other genes - baculoviral IAP repeat-containing protein 3 (also known as apoptosis inhibitor 2) and immunoglobulin heavy chain locus - in mucosa-associated lymphoid tissue lymphomas. The protein encoded by this gene may play a role in NF-kappaB activation. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene disrupts normal B cell development and leads to impaired cytokine production and T cell and B cell proliferative responses after antigen receptor engagement due to failure of NF-kappaB activation. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik A G 1: 136,216,433 S422P probably benign Het
Ankrd60 T C 2: 173,568,769 *319W probably null Het
Brd4 A G 17: 32,198,982 I1157T unknown Het
Btbd2 T C 10: 80,648,606 I159V probably benign Het
Card6 G A 15: 5,099,896 Q673* probably null Het
Cdyl T A 13: 35,872,641 Y585N probably damaging Het
Cep192 A C 18: 67,856,313 I1844L possibly damaging Het
Cfap99 G T 5: 34,302,608 C105F probably damaging Het
Clcn6 T C 4: 148,029,439 D54G probably damaging Het
Dennd5a T C 7: 109,921,507 N381S possibly damaging Het
Disp1 A C 1: 183,089,734 V374G probably damaging Het
Dock4 C T 12: 40,710,879 T522I probably benign Het
Fcer1a A G 1: 173,221,575 L223P probably damaging Het
Fstl4 C A 11: 53,168,296 D527E possibly damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm5460 A T 14: 34,035,157 T64S probably benign Het
Gys1 T C 7: 45,448,302 V491A probably benign Het
Hoxa9 A T 6: 52,225,562 N181K probably benign Het
Ift81 A T 5: 122,551,025 L676H probably damaging Het
Impad1 A T 4: 4,769,385 H243Q probably damaging Het
Itga1 T A 13: 114,992,460 D554V probably benign Het
Lin7c T A 2: 109,896,372 I122K probably damaging Het
Megf8 T C 7: 25,342,425 probably null Het
Morc2b A G 17: 33,137,007 V597A probably damaging Het
Nr1h5 T C 3: 102,949,609 I196V probably benign Het
Olfr229 T G 9: 39,910,325 I174S possibly damaging Het
Olfr434 T A 6: 43,217,016 Y34* probably null Het
Olfr963 T C 9: 39,669,075 M6T probably benign Het
Pdlim1 G A 19: 40,243,542 P131S probably benign Het
Plekhh1 T C 12: 79,070,804 I858T probably benign Het
Pls1 T C 9: 95,776,844 N197S probably benign Het
Pnmal1 A T 7: 16,961,299 T360S probably benign Het
Pon1 A T 6: 5,168,344 D354E probably benign Het
Rbp3 G A 14: 33,954,775 V227M probably benign Het
Shcbp1 T C 8: 4,744,545 K416R probably damaging Het
Slc20a2 T G 8: 22,535,492 I70S probably damaging Het
Slc7a11 A G 3: 50,372,360 I484T probably benign Het
Snrpa A G 7: 27,192,946 V63A possibly damaging Het
Stat2 CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC 10: 128,290,728 probably benign Het
Strc T C 2: 121,370,946 E1259G probably benign Het
Suds3 T G 5: 117,115,737 D26A unknown Het
Tnrc18 A G 5: 142,787,152 S641P Het
Tspan32 A G 7: 143,017,222 N189D probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Usp40 G T 1: 87,967,200 T866K probably damaging Het
Vmn1r220 G A 13: 23,183,707 T273I probably benign Het
Yes1 C T 5: 32,684,680 T516I probably damaging Het
Zbtb4 A G 11: 69,778,542 E697G probably benign Het
Zfp994 T C 17: 22,200,847 T374A possibly damaging Het
Other mutations in Malt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Malt1 APN 18 65448963 nonsense probably null
IGL01354:Malt1 APN 18 65475191 missense probably damaging 1.00
IGL01514:Malt1 APN 18 65476400 missense possibly damaging 0.74
IGL01968:Malt1 APN 18 65449016 missense probably benign 0.08
bryce_canyon UTSW 18 65462915 critical splice donor site probably null
frappe UTSW 18 65473119 missense probably benign 0.01
mousebird UTSW 18 65475260 critical splice donor site probably null
yellowstone UTSW 18 65458200 missense probably damaging 1.00
H8930:Malt1 UTSW 18 65462815 nonsense probably null
R0319:Malt1 UTSW 18 65462915 critical splice donor site probably null
R0512:Malt1 UTSW 18 65458200 missense probably damaging 1.00
R0748:Malt1 UTSW 18 65475260 critical splice donor site probably null
R2085:Malt1 UTSW 18 65473147 missense probably damaging 1.00
R2962:Malt1 UTSW 18 65448335 missense probably benign 0.01
R4193:Malt1 UTSW 18 65447675 missense probably benign 0.00
R4359:Malt1 UTSW 18 65476229 missense probably benign 0.00
R4913:Malt1 UTSW 18 65476280 missense probably damaging 1.00
R5201:Malt1 UTSW 18 65476055 missense probably benign
R5925:Malt1 UTSW 18 65431368 missense possibly damaging 0.86
R6944:Malt1 UTSW 18 65437920 missense probably benign 0.08
R7108:Malt1 UTSW 18 65464051 missense probably damaging 1.00
R7184:Malt1 UTSW 18 65447693 missense probably benign
R7192:Malt1 UTSW 18 65437827 missense probably benign 0.07
R7307:Malt1 UTSW 18 65451569 missense possibly damaging 0.48
R7308:Malt1 UTSW 18 65449609 critical splice donor site probably null
R7490:Malt1 UTSW 18 65448211 missense probably benign 0.04
R7558:Malt1 UTSW 18 65462834 missense probably damaging 1.00
R7758:Malt1 UTSW 18 65473119 missense probably benign 0.01
R7892:Malt1 UTSW 18 65464116 critical splice donor site probably null
R8112:Malt1 UTSW 18 65449609 critical splice donor site probably null
R8507:Malt1 UTSW 18 65470523 missense probably damaging 1.00
Z1177:Malt1 UTSW 18 65431373 missense probably damaging 1.00
Z1177:Malt1 UTSW 18 65448284 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAAGAATCTAACCTGTTCTGC -3'
(R):5'- CAGACTTATCACTGACTTTTACGG -3'

Sequencing Primer
(F):5'- AAGAATCTAACCTGTTCTGCCCATG -3'
(R):5'- CCTAGAATTCACTTTGTAGACCAGGC -3'
Posted On2019-11-26