Incidental Mutation 'R7756:Pdlim1'
ID597579
Institutional Source Beutler Lab
Gene Symbol Pdlim1
Ensembl Gene ENSMUSG00000055044
Gene NamePDZ and LIM domain 1 (elfin)
SynonymsCLP36, mClim1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7756 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location40221173-40271842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40243542 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 131 (P131S)
Ref Sequence ENSEMBL: ENSMUSP00000064545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068439] [ENSMUST00000182432]
Predicted Effect probably benign
Transcript: ENSMUST00000068439
AA Change: P131S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000064545
Gene: ENSMUSG00000055044
AA Change: P131S

DomainStartEndE-ValueType
PDZ 12 85 3.23e-18 SMART
Pfam:DUF4749 136 234 4.6e-29 PFAM
LIM 257 308 2.31e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182432
AA Change: P131S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138383
Gene: ENSMUSG00000055044
AA Change: P131S

DomainStartEndE-ValueType
PDZ 12 85 3.23e-18 SMART
Meta Mutation Damage Score 0.0721 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the enigma protein family. The protein contains two protein interacting domains, a PDZ domain at the amino terminal end and one to three LIM domains at the carboxyl terminal. It is a cytoplasmic protein associated with the cytoskeleton. The protein may function as an adapter to bring other LIM-interacting proteins to the cytoskeleton. Pseudogenes associated with this gene are located on chromosomes 3, 14 and 17. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit enhanced platelet response to GPVI agonists and thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik A G 1: 136,216,433 S422P probably benign Het
Ankrd60 T C 2: 173,568,769 *319W probably null Het
Brd4 A G 17: 32,198,982 I1157T unknown Het
Btbd2 T C 10: 80,648,606 I159V probably benign Het
Card6 G A 15: 5,099,896 Q673* probably null Het
Cdyl T A 13: 35,872,641 Y585N probably damaging Het
Cep192 A C 18: 67,856,313 I1844L possibly damaging Het
Cfap99 G T 5: 34,302,608 C105F probably damaging Het
Clcn6 T C 4: 148,029,439 D54G probably damaging Het
Dennd5a T C 7: 109,921,507 N381S possibly damaging Het
Disp1 A C 1: 183,089,734 V374G probably damaging Het
Dock4 C T 12: 40,710,879 T522I probably benign Het
Fcer1a A G 1: 173,221,575 L223P probably damaging Het
Fstl4 C A 11: 53,168,296 D527E possibly damaging Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm5460 A T 14: 34,035,157 T64S probably benign Het
Gys1 T C 7: 45,448,302 V491A probably benign Het
Hoxa9 A T 6: 52,225,562 N181K probably benign Het
Ift81 A T 5: 122,551,025 L676H probably damaging Het
Impad1 A T 4: 4,769,385 H243Q probably damaging Het
Itga1 T A 13: 114,992,460 D554V probably benign Het
Lin7c T A 2: 109,896,372 I122K probably damaging Het
Malt1 A G 18: 65,473,119 I622V probably benign Het
Megf8 T C 7: 25,342,425 probably null Het
Morc2b A G 17: 33,137,007 V597A probably damaging Het
Nr1h5 T C 3: 102,949,609 I196V probably benign Het
Olfr229 T G 9: 39,910,325 I174S possibly damaging Het
Olfr434 T A 6: 43,217,016 Y34* probably null Het
Olfr963 T C 9: 39,669,075 M6T probably benign Het
Plekhh1 T C 12: 79,070,804 I858T probably benign Het
Pls1 T C 9: 95,776,844 N197S probably benign Het
Pnmal1 A T 7: 16,961,299 T360S probably benign Het
Pon1 A T 6: 5,168,344 D354E probably benign Het
Rbp3 G A 14: 33,954,775 V227M probably benign Het
Shcbp1 T C 8: 4,744,545 K416R probably damaging Het
Slc20a2 T G 8: 22,535,492 I70S probably damaging Het
Slc7a11 A G 3: 50,372,360 I484T probably benign Het
Snrpa A G 7: 27,192,946 V63A possibly damaging Het
Stat2 CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC 10: 128,290,728 probably benign Het
Strc T C 2: 121,370,946 E1259G probably benign Het
Suds3 T G 5: 117,115,737 D26A unknown Het
Tnrc18 A G 5: 142,787,152 S641P Het
Tspan32 A G 7: 143,017,222 N189D probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Usp40 G T 1: 87,967,200 T866K probably damaging Het
Vmn1r220 G A 13: 23,183,707 T273I probably benign Het
Yes1 C T 5: 32,684,680 T516I probably damaging Het
Zbtb4 A G 11: 69,778,542 E697G probably benign Het
Zfp994 T C 17: 22,200,847 T374A possibly damaging Het
Other mutations in Pdlim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Pdlim1 APN 19 40243466 missense probably benign 0.00
IGL02253:Pdlim1 APN 19 40230530 missense probably damaging 0.99
IGL02312:Pdlim1 APN 19 40223061 missense probably benign 0.00
IGL02584:Pdlim1 APN 19 40243400 splice site probably null
R0391:Pdlim1 UTSW 19 40243573 missense probably damaging 0.99
R1554:Pdlim1 UTSW 19 40223072 missense probably benign 0.19
R1751:Pdlim1 UTSW 19 40251904 splice site probably benign
R1972:Pdlim1 UTSW 19 40223137 missense probably damaging 0.99
R2900:Pdlim1 UTSW 19 40223075 missense probably damaging 1.00
R4709:Pdlim1 UTSW 19 40222736 missense probably benign 0.26
R4803:Pdlim1 UTSW 19 40243448 missense possibly damaging 0.94
R4818:Pdlim1 UTSW 19 40223136 missense probably damaging 0.98
R5360:Pdlim1 UTSW 19 40230549 missense probably damaging 0.99
R5833:Pdlim1 UTSW 19 40230545 missense probably damaging 1.00
R6547:Pdlim1 UTSW 19 40223120 missense probably damaging 0.97
R7699:Pdlim1 UTSW 19 40249658 missense probably damaging 0.99
R7700:Pdlim1 UTSW 19 40249658 missense probably damaging 0.99
R7758:Pdlim1 UTSW 19 40243542 missense probably benign 0.00
R7914:Pdlim1 UTSW 19 40252001 missense probably damaging 0.98
R8201:Pdlim1 UTSW 19 40230514 missense probably benign
R8331:Pdlim1 UTSW 19 40230551 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CCCAGGCTTAGTAGTTCACC -3'
(R):5'- GAAGTTTAGATTTGAGCCAGGGC -3'

Sequencing Primer
(F):5'- GGAAAGAGTCTCCCTTTCCCAG -3'
(R):5'- CTGCTGTAGCTTAGCTGGAAGTCC -3'
Posted On2019-11-26