Incidental Mutation 'R7757:Snx21'
ID 597588
Institutional Source Beutler Lab
Gene Symbol Snx21
Ensembl Gene ENSMUSG00000050373
Gene Name sorting nexin family member 21
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7757 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 164785823-164793816 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 164786165 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 34 (S34P)
Ref Sequence ENSEMBL: ENSMUSP00000054137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056181] [ENSMUST00000152471] [ENSMUST00000172577] [ENSMUST00000174070]
AlphaFold Q3UR97
Predicted Effect probably damaging
Transcript: ENSMUST00000056181
AA Change: S34P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054137
Gene: ENSMUSG00000050373
AA Change: S34P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
PX 124 232 4.19e-10 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 334 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140519
Predicted Effect probably damaging
Transcript: ENSMUST00000152471
AA Change: S34P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133914
Gene: ENSMUSG00000050373
AA Change: S34P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172577
AA Change: S34P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134133
Gene: ENSMUSG00000050373
AA Change: S34P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174070
AA Change: S34P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133344
Gene: ENSMUSG00000050373
AA Change: S34P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
Meta Mutation Damage Score 0.0809 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members. The specific function of this protein has not been determined. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A T 15: 8,252,227 E2850V unknown Het
2700049A03Rik G A 12: 71,189,413 M1179I probably benign Het
6430550D23Rik T C 2: 156,003,431 T18A possibly damaging Het
Acox2 T C 14: 8,230,166 N659S probably damaging Het
Agk T C 6: 40,376,278 V192A possibly damaging Het
Ap3b1 T A 13: 94,528,158 probably null Het
Bche T A 3: 73,701,121 D324V probably damaging Het
Bsn A G 9: 108,114,740 I1271T possibly damaging Het
Capn12 T C 7: 28,882,821 L120P probably damaging Het
Cep290 T A 10: 100,563,434 S2273T probably benign Het
Ckap4 T C 10: 84,528,467 E244G probably damaging Het
Clcn7 T C 17: 25,156,822 Y545H probably damaging Het
Cmya5 T A 13: 93,098,272 T103S possibly damaging Het
Cpne9 G A 6: 113,284,445 V121M possibly damaging Het
Csmd2 T A 4: 128,483,456 I2043N Het
Disc1 A G 8: 125,087,504 T36A probably benign Het
Disp2 T C 2: 118,790,910 Y708H probably damaging Het
Dnah3 A G 7: 120,071,570 V635A probably benign Het
Dnah3 A T 7: 119,971,215 probably null Het
Dync1li1 A G 9: 114,709,277 H234R possibly damaging Het
Egfr T C 11: 16,889,966 V660A possibly damaging Het
Epb42 T C 2: 121,027,719 R253G possibly damaging Het
Fat2 T A 11: 55,311,421 T276S probably benign Het
Fcho2 A G 13: 98,764,503 probably null Het
Ginm1 A T 10: 7,779,355 I41N probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm49368 C T 7: 128,112,226 R701C probably damaging Het
Gpr37 T A 6: 25,688,208 I297F probably benign Het
Gprc5a T A 6: 135,079,344 I263N possibly damaging Het
Gys2 A T 6: 142,454,451 S345T probably benign Het
Hk2 T C 6: 82,742,915 M255V possibly damaging Het
Ibtk A C 9: 85,697,237 S1202A possibly damaging Het
Il23r T G 6: 67,423,981 D455A probably benign Het
Irs2 T A 8: 11,006,522 K637* probably null Het
Jak2 T C 19: 29,283,546 V314A probably benign Het
Mei1 C T 15: 82,082,623 probably benign Het
Mill1 T C 7: 18,262,466 M69T probably benign Het
Mms22l T C 4: 24,598,884 probably null Het
Mup8 C A 4: 60,220,332 Q133H probably benign Het
Mup8 T A 4: 60,220,333 Q133L probably benign Het
Mycbp2 A T 14: 103,191,619 Y2374N probably damaging Het
Nbeal1 A T 1: 60,257,450 K1166N probably damaging Het
Nlrc4 T A 17: 74,448,196 R8S probably benign Het
Nrcam C T 12: 44,549,898 Q25* probably null Het
Nudt16 A C 9: 105,131,561 M47R probably damaging Het
Nup62 T C 7: 44,828,995 S145P probably benign Het
Olfr1222 T C 2: 89,124,989 I247M possibly damaging Het
Olfr959 A G 9: 39,572,465 W265R probably benign Het
Osbpl1a A T 18: 12,933,600 V34D probably benign Het
Otogl T A 10: 107,876,921 N521Y probably damaging Het
Pcdhb14 T A 18: 37,449,834 D664E possibly damaging Het
Pex5l T C 3: 33,082,151 probably benign Het
Pkhd1 A G 1: 20,562,415 L592P probably damaging Het
Plxdc2 A G 2: 16,729,376 H480R probably benign Het
Rnf216 T A 5: 143,080,236 K532N probably damaging Het
Schip1 C A 3: 68,617,695 Q358K probably damaging Het
Sdc2 A T 15: 33,028,087 E117V possibly damaging Het
Sept11 A T 5: 93,171,464 probably null Het
Shprh A T 10: 11,162,180 E420V probably benign Het
Ska1 T A 18: 74,196,973 H232L probably benign Het
Slc36a4 A G 9: 15,719,660 N25S possibly damaging Het
Slitrk3 G A 3: 73,050,839 T200M probably damaging Het
Smad2 C T 18: 76,288,013 H138Y probably benign Het
Sos2 A G 12: 69,648,585 V126A probably damaging Het
Srcap C T 7: 127,530,794 T596I probably damaging Het
Stk31 T G 6: 49,406,943 probably null Het
Stox1 T C 10: 62,663,964 D939G probably damaging Het
Syne2 G T 12: 76,061,779 C979F possibly damaging Het
Tanc2 C A 11: 105,776,858 N88K possibly damaging Het
Tll2 A T 19: 41,096,008 V677E probably damaging Het
Ttn T C 2: 76,918,490 T4072A probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Unc13b AGAGCC AGAGCCCGAGCC 4: 43,177,330 probably benign Het
Unc13b CAGAGC CAGAGCGAGAGC 4: 43,177,341 probably benign Het
Vmn2r43 A T 7: 8,255,254 F320Y possibly damaging Het
Zscan4f G T 7: 11,401,278 G204* probably null Het
Other mutations in Snx21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Snx21 APN 2 164786220 missense probably damaging 1.00
IGL02329:Snx21 APN 2 164792390 utr 3 prime probably benign
R4162:Snx21 UTSW 2 164786850 missense probably damaging 1.00
R4164:Snx21 UTSW 2 164786850 missense probably damaging 1.00
R5092:Snx21 UTSW 2 164786746 missense probably damaging 0.99
R5262:Snx21 UTSW 2 164791821 missense probably damaging 0.99
R6875:Snx21 UTSW 2 164791902 missense probably damaging 1.00
R7231:Snx21 UTSW 2 164786201 missense probably benign 0.00
R8001:Snx21 UTSW 2 164786737 missense probably benign 0.03
R8341:Snx21 UTSW 2 164791885 missense probably damaging 1.00
R8796:Snx21 UTSW 2 164786829 missense possibly damaging 0.53
R9340:Snx21 UTSW 2 164791929 utr 3 prime probably benign
R9741:Snx21 UTSW 2 164792311 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAAATCCGCCAGGCTGCTG -3'
(R):5'- GAGAAAACTCAGGATGCCCTC -3'

Sequencing Primer
(F):5'- TGCACCAAATCCCGGGAG -3'
(R):5'- CCGGGGTTCCTGTCTGTC -3'
Posted On 2019-11-26