Mutagenetix > Incidental Mutation

Incidental Mutation 'R7757:Slitrk3'

597591

Institutional Source

Beutler Lab

Gene Symbol

Slitrk3

Ensembl Gene

ENSMUSG00000048304

Gene Name

SLIT and NTRK-like family, member 3

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.704) question?

Stock #

R7757 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73047265-73057803 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 73050839 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 200 (T200M)

Ref Sequence

ENSEMBL: ENSMUSP00000088561 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059407] [ENSMUST00000192477]

AlphaFold

Q810B9

Predicted Effect

probably damaging
Transcript: ENSMUST00000059407
AA Change: T200M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088561
Gene: ENSMUSG00000048304
AA Change: T200M

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Blast:LRRNT	44	79	3e-11	BLAST
LRR	101	124	2.08e1	SMART
LRR	125	148	6.05e0	SMART
LRR	149	172	3.97e0	SMART
LRR_TYP	173	196	1.67e-2	SMART
LRR	197	220	2.69e2	SMART
LRRCT	233	283	4.56e-5	SMART
low complexity region	332	350	N/A	INTRINSIC
LRRNT	373	411	4.17e0	SMART
LRR	432	455	1.62e0	SMART
LRR_TYP	456	479	2.61e-4	SMART
LRR	480	503	2.82e0	SMART
LRR_TYP	504	527	6.99e-5	SMART
LRRCT	563	613	3.22e-5	SMART
transmembrane domain	658	680	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
low complexity region	836	843	N/A	INTRINSIC
low complexity region	846	858	N/A	INTRINSIC
low complexity region	870	888	N/A	INTRINSIC
Blast:LRRCT	906	943	2e-16	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000192477
AA Change: T200M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141236
Gene: ENSMUSG00000048304
AA Change: T200M

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Blast:LRRNT	44	79	3e-11	BLAST
LRR	101	124	2.08e1	SMART
LRR	125	148	6.05e0	SMART
LRR	149	172	3.97e0	SMART
LRR_TYP	173	196	1.67e-2	SMART
LRR	197	220	2.69e2	SMART
LRRCT	233	283	4.56e-5	SMART
low complexity region	332	350	N/A	INTRINSIC
LRRNT	373	411	4.17e0	SMART
LRR	432	455	1.62e0	SMART
LRR_TYP	456	479	2.61e-4	SMART
LRR	480	503	2.82e0	SMART
LRR_TYP	504	527	6.99e-5	SMART
LRRCT	563	613	3.22e-5	SMART
transmembrane domain	658	680	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
low complexity region	836	843	N/A	INTRINSIC
low complexity region	846	858	N/A	INTRINSIC
low complexity region	870	888	N/A	INTRINSIC
Blast:LRRCT	906	943	2e-16	BLAST

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

96% (70/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Slitrk family of structurally related transmembrane proteins that are involved in controlling neurite outgrowth. The encoded protein contains two leucine-rich repeat (LRR) domains and a C-terminal domain that is partially similar to Trk neurotrophin receptor protein. Enhanced expression of this gene was found in tissue from several different types of tumors. Alternative splicing results in multiple transcript variants, all encoding the same protein. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out mice exhibit reduced inhibitory synapse density, decreased miniature inhibitory postsynaptic current frequency and increased susceptibility to spontaneous and pharmacologically-induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	A	T	15: 8,252,227	E2850V	unknown	Het
2700049A03Rik	G	A	12: 71,189,413	M1179I	probably benign	Het
6430550D23Rik	T	C	2: 156,003,431	T18A	possibly damaging	Het
Acox2	T	C	14: 8,230,166	N659S	probably damaging	Het
Agk	T	C	6: 40,376,278	V192A	possibly damaging	Het
Ap3b1	T	A	13: 94,528,158		probably null	Het
Bche	T	A	3: 73,701,121	D324V	probably damaging	Het
Bsn	A	G	9: 108,114,740	I1271T	possibly damaging	Het
Capn12	T	C	7: 28,882,821	L120P	probably damaging	Het
Cep290	T	A	10: 100,563,434	S2273T	probably benign	Het
Ckap4	T	C	10: 84,528,467	E244G	probably damaging	Het
Clcn7	T	C	17: 25,156,822	Y545H	probably damaging	Het
Cmya5	T	A	13: 93,098,272	T103S	possibly damaging	Het
Cpne9	G	A	6: 113,284,445	V121M	possibly damaging	Het
Csmd2	T	A	4: 128,483,456	I2043N		Het
Disc1	A	G	8: 125,087,504	T36A	probably benign	Het
Disp2	T	C	2: 118,790,910	Y708H	probably damaging	Het
Dnah3	A	G	7: 120,071,570	V635A	probably benign	Het
Dnah3	A	T	7: 119,971,215		probably null	Het
Dync1li1	A	G	9: 114,709,277	H234R	possibly damaging	Het
Egfr	T	C	11: 16,889,966	V660A	possibly damaging	Het
Epb42	T	C	2: 121,027,719	R253G	possibly damaging	Het
Fat2	T	A	11: 55,311,421	T276S	probably benign	Het
Fcho2	A	G	13: 98,764,503		probably null	Het
Ginm1	A	T	10: 7,779,355	I41N	probably damaging	Het
Gm4744	A	G	6: 40,950,433		probably benign	Het
Gm49368	C	T	7: 128,112,226	R701C	probably damaging	Het
Gpr37	T	A	6: 25,688,208	I297F	probably benign	Het
Gprc5a	T	A	6: 135,079,344	I263N	possibly damaging	Het
Gys2	A	T	6: 142,454,451	S345T	probably benign	Het
Hk2	T	C	6: 82,742,915	M255V	possibly damaging	Het
Ibtk	A	C	9: 85,697,237	S1202A	possibly damaging	Het
Il23r	T	G	6: 67,423,981	D455A	probably benign	Het
Irs2	T	A	8: 11,006,522	K637*	probably null	Het
Jak2	T	C	19: 29,283,546	V314A	probably benign	Het
Mei1	C	T	15: 82,082,623		probably benign	Het
Mill1	T	C	7: 18,262,466	M69T	probably benign	Het
Mms22l	T	C	4: 24,598,884		probably null	Het
Mup8	C	A	4: 60,220,332	Q133H	probably benign	Het
Mup8	T	A	4: 60,220,333	Q133L	probably benign	Het
Mycbp2	A	T	14: 103,191,619	Y2374N	probably damaging	Het
Nbeal1	A	T	1: 60,257,450	K1166N	probably damaging	Het
Nlrc4	T	A	17: 74,448,196	R8S	probably benign	Het
Nrcam	C	T	12: 44,549,898	Q25*	probably null	Het
Nudt16	A	C	9: 105,131,561	M47R	probably damaging	Het
Nup62	T	C	7: 44,828,995	S145P	probably benign	Het
Olfr1222	T	C	2: 89,124,989	I247M	possibly damaging	Het
Olfr959	A	G	9: 39,572,465	W265R	probably benign	Het
Osbpl1a	A	T	18: 12,933,600	V34D	probably benign	Het
Otogl	T	A	10: 107,876,921	N521Y	probably damaging	Het
Pcdhb14	T	A	18: 37,449,834	D664E	possibly damaging	Het
Pex5l	T	C	3: 33,082,151		probably benign	Het
Pkhd1	A	G	1: 20,562,415	L592P	probably damaging	Het
Plxdc2	A	G	2: 16,729,376	H480R	probably benign	Het
Rnf216	T	A	5: 143,080,236	K532N	probably damaging	Het
Schip1	C	A	3: 68,617,695	Q358K	probably damaging	Het
Sdc2	A	T	15: 33,028,087	E117V	possibly damaging	Het
Sept11	A	T	5: 93,171,464		probably null	Het
Shprh	A	T	10: 11,162,180	E420V	probably benign	Het
Ska1	T	A	18: 74,196,973	H232L	probably benign	Het
Slc36a4	A	G	9: 15,719,660	N25S	possibly damaging	Het
Smad2	C	T	18: 76,288,013	H138Y	probably benign	Het
Snx21	T	C	2: 164,786,165	S34P	probably damaging	Het
Sos2	A	G	12: 69,648,585	V126A	probably damaging	Het
Srcap	C	T	7: 127,530,794	T596I	probably damaging	Het
Stk31	T	G	6: 49,406,943		probably null	Het
Stox1	T	C	10: 62,663,964	D939G	probably damaging	Het
Syne2	G	T	12: 76,061,779	C979F	possibly damaging	Het
Tanc2	C	A	11: 105,776,858	N88K	possibly damaging	Het
Tll2	A	T	19: 41,096,008	V677E	probably damaging	Het
Ttn	T	C	2: 76,918,490	T4072A	probably benign	Het
Unc13b	CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC	CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC	4: 43,177,312		probably benign	Het
Unc13b	AGAGCC	AGAGCCCGAGCC	4: 43,177,330		probably benign	Het
Unc13b	CAGAGC	CAGAGCGAGAGC	4: 43,177,341		probably benign	Het
Vmn2r43	A	T	7: 8,255,254	F320Y	possibly damaging	Het
Zscan4f	G	T	7: 11,401,278	G204*	probably null	Het

Other mutations in Slitrk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Slitrk3	APN	3	73051103	missense	probably damaging	1.00
IGL00857:Slitrk3	APN	3	73049841	missense	probably damaging	1.00
IGL00990:Slitrk3	APN	3	73050081	missense	probably damaging	1.00
IGL01010:Slitrk3	APN	3	73049273	missense	probably benign	0.14
IGL01299:Slitrk3	APN	3	73049016	missense	probably benign	0.43
IGL01609:Slitrk3	APN	3	73050237	missense	probably damaging	1.00
IGL01881:Slitrk3	APN	3	73049306	missense	probably benign	0.00
IGL01941:Slitrk3	APN	3	73051071	missense	possibly damaging	0.72
IGL02183:Slitrk3	APN	3	73049979	missense	probably damaging	0.97
IGL02187:Slitrk3	APN	3	73050272	missense	probably damaging	1.00
IGL02478:Slitrk3	APN	3	73050713	missense	probably damaging	0.96
IGL02512:Slitrk3	APN	3	73050402	missense	probably benign	0.28
IGL02720:Slitrk3	APN	3	73050768	missense	probably damaging	1.00
IGL03113:Slitrk3	APN	3	73050390	missense	probably benign	0.00
IGL03224:Slitrk3	APN	3	73049930	missense	possibly damaging	0.72
wee	UTSW	3	73050785	missense	probably damaging	1.00
R0233:Slitrk3	UTSW	3	73048577	missense	probably benign	0.00
R0233:Slitrk3	UTSW	3	73048577	missense	probably benign	0.00
R0639:Slitrk3	UTSW	3	73049649	missense	probably benign	0.02
R1448:Slitrk3	UTSW	3	73050341	missense	probably damaging	0.99
R1656:Slitrk3	UTSW	3	73050339	missense	probably damaging	0.98
R1713:Slitrk3	UTSW	3	73049691	missense	probably benign	0.00
R1992:Slitrk3	UTSW	3	73049771	missense	possibly damaging	0.80
R1999:Slitrk3	UTSW	3	73049964	missense	probably benign	0.13
R2359:Slitrk3	UTSW	3	73049345	missense	possibly damaging	0.56
R3083:Slitrk3	UTSW	3	73048595	missense	probably benign	0.00
R3153:Slitrk3	UTSW	3	73048982	nonsense	probably null
R3821:Slitrk3	UTSW	3	73049216	missense	possibly damaging	0.94
R4208:Slitrk3	UTSW	3	73051157	missense	possibly damaging	0.67
R4323:Slitrk3	UTSW	3	73050785	missense	probably damaging	1.00
R4580:Slitrk3	UTSW	3	73051206	missense	probably damaging	0.96
R4730:Slitrk3	UTSW	3	73049519	missense	probably benign	0.08
R4742:Slitrk3	UTSW	3	73048565	missense	probably benign	0.00
R4979:Slitrk3	UTSW	3	73049796	missense	possibly damaging	0.95
R5018:Slitrk3	UTSW	3	73050512	missense	probably benign	0.31
R5023:Slitrk3	UTSW	3	73050648	missense	probably benign	0.24
R5057:Slitrk3	UTSW	3	73050648	missense	probably benign	0.24
R5156:Slitrk3	UTSW	3	73049259	missense	probably benign
R5500:Slitrk3	UTSW	3	73050347	missense	probably damaging	1.00
R5582:Slitrk3	UTSW	3	73050404	missense	probably benign	0.09
R5797:Slitrk3	UTSW	3	73048629	missense	probably damaging	0.99
R5963:Slitrk3	UTSW	3	73050713	missense	probably benign	0.30
R5985:Slitrk3	UTSW	3	73050900	missense	probably damaging	1.00
R6123:Slitrk3	UTSW	3	73049762	missense	probably damaging	1.00
R6393:Slitrk3	UTSW	3	73049914	missense	possibly damaging	0.79
R6529:Slitrk3	UTSW	3	73051218	missense	probably benign	0.02
R6584:Slitrk3	UTSW	3	73049225	missense	probably damaging	0.99
R6645:Slitrk3	UTSW	3	73049861	missense	probably benign	0.13
R7001:Slitrk3	UTSW	3	73050609	nonsense	probably null
R7282:Slitrk3	UTSW	3	73050465	missense	possibly damaging	0.70
R7534:Slitrk3	UTSW	3	73050107	missense	probably damaging	0.98
R7577:Slitrk3	UTSW	3	73051115	missense	probably damaging	0.99
R8251:Slitrk3	UTSW	3	73049396	missense	possibly damaging	0.67
R8354:Slitrk3	UTSW	3	73049180	missense	probably benign	0.08
R8454:Slitrk3	UTSW	3	73049180	missense	probably benign	0.08
R8488:Slitrk3	UTSW	3	73051187	missense	probably benign	0.02
R8491:Slitrk3	UTSW	3	73051259	missense	possibly damaging	0.89
R8843:Slitrk3	UTSW	3	73048831	missense	probably benign	0.04
R9140:Slitrk3	UTSW	3	73050459	missense	probably benign	0.02
R9451:Slitrk3	UTSW	3	73051283	missense	possibly damaging	0.83
R9511:Slitrk3	UTSW	3	73050939	missense	possibly damaging	0.46
R9575:Slitrk3	UTSW	3	73048794	missense	probably benign	0.00
R9589:Slitrk3	UTSW	3	73050648	missense	probably benign	0.24
R9603:Slitrk3	UTSW	3	73051316	missense	probably benign	0.00
X0022:Slitrk3	UTSW	3	73050266	missense	probably damaging	1.00
Z1176:Slitrk3	UTSW	3	73048770	missense	probably benign	0.09
Z1177:Slitrk3	UTSW	3	73049142	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGAGATCCTTCCCATGGAAATG -3'
(R):5'- TTCAGAAATGACACCTTCCTTGG -3'

Sequencing Primer
(F):5'- AAGGTGTCTCACAGGTAATGTCTCC -3'
(R):5'- GACACCTTCCTTGGCTTAGAAAG -3'

Posted On

2019-11-26