Incidental Mutation 'R7757:Gpr37'
ID 597601
Institutional Source Beutler Lab
Gene Symbol Gpr37
Ensembl Gene ENSMUSG00000039904
Gene Name G protein-coupled receptor 37
Synonyms parkin-associated endothelin B-like receptor, Pael-R
MMRRC Submission 045813-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.157) question?
Stock # R7757 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 25668522-25689979 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 25688207 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 297 (I297F)
Ref Sequence ENSEMBL: ENSMUSP00000052185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054867] [ENSMUST00000200812]
AlphaFold Q9QY42
Predicted Effect probably benign
Transcript: ENSMUST00000054867
AA Change: I297F

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000052185
Gene: ENSMUSG00000039904
AA Change: I297F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
Pfam:7tm_1 265 536 5.2e-33 PFAM
low complexity region 549 558 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200812
AA Change: I297F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144683
Gene: ENSMUSG00000039904
AA Change: I297F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
Pfam:7tm_1 265 421 3.4e-26 PFAM
Meta Mutation Damage Score 0.1047 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the G protein-coupled receptor family. The encoded protein contains seven transmembrane domains and is found in cell and endoplasmic reticulum membranes. G protein-coupled receptors are involved in translating outside signals into G protein mediated intracellular effects. This gene product interacts with Parkin and is involved in juvenile Parkinson disease. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit reduced striatal dopamine content, enhanced amphetamine sensitivity, reduced motor activity and coordination and increased percentage of body fat in females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,236,187 (GRCm39) M1179I probably benign Het
6430550D23Rik T C 2: 155,845,351 (GRCm39) T18A possibly damaging Het
Acox2 T C 14: 8,230,166 (GRCm38) N659S probably damaging Het
Agk T C 6: 40,353,212 (GRCm39) V192A possibly damaging Het
Ap3b1 T A 13: 94,664,666 (GRCm39) probably null Het
Bche T A 3: 73,608,454 (GRCm39) D324V probably damaging Het
Bsn A G 9: 107,991,939 (GRCm39) I1271T possibly damaging Het
Capn12 T C 7: 28,582,246 (GRCm39) L120P probably damaging Het
Cep290 T A 10: 100,399,296 (GRCm39) S2273T probably benign Het
Ckap4 T C 10: 84,364,331 (GRCm39) E244G probably damaging Het
Clcn7 T C 17: 25,375,796 (GRCm39) Y545H probably damaging Het
Cmya5 T A 13: 93,234,780 (GRCm39) T103S possibly damaging Het
Cplane1 A T 15: 8,281,711 (GRCm39) E2850V unknown Het
Cpne9 G A 6: 113,261,406 (GRCm39) V121M possibly damaging Het
Csmd2 T A 4: 128,377,249 (GRCm39) I2043N Het
Disc1 A G 8: 125,814,243 (GRCm39) T36A probably benign Het
Disp2 T C 2: 118,621,391 (GRCm39) Y708H probably damaging Het
Dnah3 A G 7: 119,670,793 (GRCm39) V635A probably benign Het
Dnah3 A T 7: 119,570,438 (GRCm39) probably null Het
Dync1li1 A G 9: 114,538,345 (GRCm39) H234R possibly damaging Het
Egfr T C 11: 16,839,966 (GRCm39) V660A possibly damaging Het
Epb42 T C 2: 120,858,200 (GRCm39) R253G possibly damaging Het
Fat2 T A 11: 55,202,247 (GRCm39) T276S probably benign Het
Fcho2 A G 13: 98,901,011 (GRCm39) probably null Het
Ginm1 A T 10: 7,655,119 (GRCm39) I41N probably damaging Het
Gm4744 A G 6: 40,927,367 (GRCm39) probably benign Het
Gm49368 C T 7: 127,711,398 (GRCm39) R701C probably damaging Het
Gprc5a T A 6: 135,056,342 (GRCm39) I263N possibly damaging Het
Gys2 A T 6: 142,400,177 (GRCm39) S345T probably benign Het
Hk2 T C 6: 82,719,896 (GRCm39) M255V possibly damaging Het
Ibtk A C 9: 85,579,290 (GRCm39) S1202A possibly damaging Het
Il23r T G 6: 67,400,965 (GRCm39) D455A probably benign Het
Irs2 T A 8: 11,056,522 (GRCm39) K637* probably null Het
Jak2 T C 19: 29,260,946 (GRCm39) V314A probably benign Het
Mei1 C T 15: 81,966,824 (GRCm39) probably benign Het
Mill1 T C 7: 17,996,391 (GRCm39) M69T probably benign Het
Mms22l T C 4: 24,598,884 (GRCm39) probably null Het
Mup8 C A 4: 60,220,332 (GRCm39) Q133H probably benign Het
Mup8 T A 4: 60,220,333 (GRCm39) Q133L probably benign Het
Mycbp2 A T 14: 103,429,055 (GRCm39) Y2374N probably damaging Het
Nbeal1 A T 1: 60,296,609 (GRCm39) K1166N probably damaging Het
Nlrc4 T A 17: 74,755,191 (GRCm39) R8S probably benign Het
Nrcam C T 12: 44,596,681 (GRCm39) Q25* probably null Het
Nudt16 A C 9: 105,008,760 (GRCm39) M47R probably damaging Het
Nup62 T C 7: 44,478,419 (GRCm39) S145P probably benign Het
Or10d1 A G 9: 39,483,761 (GRCm39) W265R probably benign Het
Or4c117 T C 2: 88,955,333 (GRCm39) I247M possibly damaging Het
Osbpl1a A T 18: 13,066,657 (GRCm39) V34D probably benign Het
Otogl T A 10: 107,712,782 (GRCm39) N521Y probably damaging Het
Pcdhb14 T A 18: 37,582,887 (GRCm39) D664E possibly damaging Het
Pex5l T C 3: 33,136,300 (GRCm39) probably benign Het
Pkhd1 A G 1: 20,632,639 (GRCm39) L592P probably damaging Het
Plxdc2 A G 2: 16,734,187 (GRCm39) H480R probably benign Het
Rnf216 T A 5: 143,065,991 (GRCm39) K532N probably damaging Het
Schip1 C A 3: 68,525,028 (GRCm39) Q358K probably damaging Het
Sdc2 A T 15: 33,028,233 (GRCm39) E117V possibly damaging Het
Septin11 A T 5: 93,319,323 (GRCm39) probably null Het
Shprh A T 10: 11,037,924 (GRCm39) E420V probably benign Het
Ska1 T A 18: 74,330,044 (GRCm39) H232L probably benign Het
Slc36a4 A G 9: 15,630,956 (GRCm39) N25S possibly damaging Het
Slitrk3 G A 3: 72,958,172 (GRCm39) T200M probably damaging Het
Smad2 C T 18: 76,421,084 (GRCm39) H138Y probably benign Het
Snx21 T C 2: 164,628,085 (GRCm39) S34P probably damaging Het
Sos2 A G 12: 69,695,359 (GRCm39) V126A probably damaging Het
Srcap C T 7: 127,129,966 (GRCm39) T596I probably damaging Het
Stk31 T G 6: 49,383,877 (GRCm39) probably null Het
Stox1 T C 10: 62,499,743 (GRCm39) D939G probably damaging Het
Syne2 G T 12: 76,108,553 (GRCm39) C979F possibly damaging Het
Tanc2 C A 11: 105,667,684 (GRCm39) N88K possibly damaging Het
Tll2 A T 19: 41,084,447 (GRCm39) V677E probably damaging Het
Ttn T C 2: 76,748,834 (GRCm39) T4072A probably benign Het
Unc13b CAGAGC CAGAGCGAGAGC 4: 43,177,341 (GRCm39) probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 (GRCm39) probably benign Het
Unc13b AGAGCC AGAGCCCGAGCC 4: 43,177,330 (GRCm39) probably benign Het
Vmn2r43 A T 7: 8,258,253 (GRCm39) F320Y possibly damaging Het
Zscan4f G T 7: 11,135,205 (GRCm39) G204* probably null Het
Other mutations in Gpr37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Gpr37 APN 6 25,669,317 (GRCm39) missense possibly damaging 0.65
IGL01595:Gpr37 APN 6 25,669,572 (GRCm39) missense probably damaging 1.00
IGL01670:Gpr37 APN 6 25,669,833 (GRCm39) missense probably damaging 1.00
IGL02552:Gpr37 APN 6 25,688,686 (GRCm39) missense probably benign 0.05
IGL03331:Gpr37 APN 6 25,669,728 (GRCm39) missense probably benign 0.26
R0375:Gpr37 UTSW 6 25,669,290 (GRCm39) missense probably benign 0.08
R0534:Gpr37 UTSW 6 25,669,823 (GRCm39) nonsense probably null
R0892:Gpr37 UTSW 6 25,688,206 (GRCm39) missense probably damaging 1.00
R1481:Gpr37 UTSW 6 25,669,137 (GRCm39) missense probably damaging 0.99
R1700:Gpr37 UTSW 6 25,669,623 (GRCm39) missense probably benign 0.09
R2083:Gpr37 UTSW 6 25,688,416 (GRCm39) missense possibly damaging 0.62
R2089:Gpr37 UTSW 6 25,689,062 (GRCm39) missense possibly damaging 0.73
R2091:Gpr37 UTSW 6 25,689,062 (GRCm39) missense possibly damaging 0.73
R2091:Gpr37 UTSW 6 25,689,062 (GRCm39) missense possibly damaging 0.73
R2112:Gpr37 UTSW 6 25,669,380 (GRCm39) missense possibly damaging 0.91
R2847:Gpr37 UTSW 6 25,666,945 (GRCm39) unclassified probably benign
R2848:Gpr37 UTSW 6 25,666,945 (GRCm39) unclassified probably benign
R4119:Gpr37 UTSW 6 25,688,425 (GRCm39) missense possibly damaging 0.90
R4611:Gpr37 UTSW 6 25,669,623 (GRCm39) missense probably benign 0.09
R4734:Gpr37 UTSW 6 25,689,085 (GRCm39) missense possibly damaging 0.53
R4765:Gpr37 UTSW 6 25,669,107 (GRCm39) missense probably damaging 1.00
R5163:Gpr37 UTSW 6 25,669,614 (GRCm39) missense possibly damaging 0.87
R5669:Gpr37 UTSW 6 25,669,351 (GRCm39) missense probably benign 0.05
R6548:Gpr37 UTSW 6 25,688,812 (GRCm39) missense probably benign 0.32
R6760:Gpr37 UTSW 6 25,669,168 (GRCm39) missense probably benign 0.00
R7030:Gpr37 UTSW 6 25,689,004 (GRCm39) missense possibly damaging 0.92
R7278:Gpr37 UTSW 6 25,669,341 (GRCm39) missense possibly damaging 0.68
R7392:Gpr37 UTSW 6 25,688,786 (GRCm39) missense probably benign 0.34
R7726:Gpr37 UTSW 6 25,669,116 (GRCm39) missense possibly damaging 0.94
R7754:Gpr37 UTSW 6 25,689,049 (GRCm39) missense probably damaging 0.99
R8344:Gpr37 UTSW 6 25,669,530 (GRCm39) missense probably damaging 1.00
R8734:Gpr37 UTSW 6 25,688,201 (GRCm39) missense probably benign 0.17
R8839:Gpr37 UTSW 6 25,669,369 (GRCm39) missense probably benign 0.15
V7732:Gpr37 UTSW 6 25,669,122 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACACGTGCTTGCATAAGTG -3'
(R):5'- GAAGAACCCCTTCTACCCATTG -3'

Sequencing Primer
(F):5'- CACGTGCTTGCATAAGTGACTGG -3'
(R):5'- TTGACCCAAGAATCCTACGGAG -3'
Posted On 2019-11-26