Incidental Mutation 'R7757:Hk2'
ID 597605
Institutional Source Beutler Lab
Gene Symbol Hk2
Ensembl Gene ENSMUSG00000000628
Gene Name hexokinase 2
Synonyms HKII
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7757 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 82725025-82774454 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 82742915 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 255 (M255V)
Ref Sequence ENSEMBL: ENSMUSP00000000642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000642] [ENSMUST00000170833]
AlphaFold O08528
Predicted Effect possibly damaging
Transcript: ENSMUST00000000642
AA Change: M255V

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000000642
Gene: ENSMUSG00000000628
AA Change: M255V

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 220 9.8e-78 PFAM
Pfam:Hexokinase_2 225 459 4.9e-85 PFAM
Pfam:Hexokinase_1 469 668 6.4e-80 PFAM
Pfam:Hexokinase_2 673 907 8.7e-85 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170833
AA Change: M227V

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125986
Gene: ENSMUSG00000000628
AA Change: M227V

DomainStartEndE-ValueType
Pfam:Hexokinase_1 1 193 5.5e-89 PFAM
Pfam:Hexokinase_2 195 434 5.3e-107 PFAM
Pfam:Hexokinase_1 436 641 5.9e-91 PFAM
Pfam:Hexokinase_2 643 882 1.3e-109 PFAM
Meta Mutation Damage Score 0.3825 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes hexokinase 2, the predominant form found in skeletal muscle. It localizes to the outer membrane of mitochondria. Expression of this gene is insulin-responsive, and studies in rat suggest that it is involved in the increased rate of glycolysis seen in rapidly growing cancer cells. [provided by RefSeq, Apr 2009]
PHENOTYPE: Embryos homozygous for a knock-out mutation are severely growth retarded and die around E8.5. Interestingly, heterozygous mutant mice are viable and fertile, develop normally and do not exhibit impaired insulin action or glucose tolerance even when challenged with a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A T 15: 8,252,227 E2850V unknown Het
2700049A03Rik G A 12: 71,189,413 M1179I probably benign Het
6430550D23Rik T C 2: 156,003,431 T18A possibly damaging Het
Acox2 T C 14: 8,230,166 N659S probably damaging Het
Agk T C 6: 40,376,278 V192A possibly damaging Het
Ap3b1 T A 13: 94,528,158 probably null Het
Bche T A 3: 73,701,121 D324V probably damaging Het
Bsn A G 9: 108,114,740 I1271T possibly damaging Het
Capn12 T C 7: 28,882,821 L120P probably damaging Het
Cep290 T A 10: 100,563,434 S2273T probably benign Het
Ckap4 T C 10: 84,528,467 E244G probably damaging Het
Clcn7 T C 17: 25,156,822 Y545H probably damaging Het
Cmya5 T A 13: 93,098,272 T103S possibly damaging Het
Cpne9 G A 6: 113,284,445 V121M possibly damaging Het
Csmd2 T A 4: 128,483,456 I2043N Het
Disc1 A G 8: 125,087,504 T36A probably benign Het
Disp2 T C 2: 118,790,910 Y708H probably damaging Het
Dnah3 A G 7: 120,071,570 V635A probably benign Het
Dnah3 A T 7: 119,971,215 probably null Het
Dync1li1 A G 9: 114,709,277 H234R possibly damaging Het
Egfr T C 11: 16,889,966 V660A possibly damaging Het
Epb42 T C 2: 121,027,719 R253G possibly damaging Het
Fat2 T A 11: 55,311,421 T276S probably benign Het
Fcho2 A G 13: 98,764,503 probably null Het
Ginm1 A T 10: 7,779,355 I41N probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm49368 C T 7: 128,112,226 R701C probably damaging Het
Gpr37 T A 6: 25,688,208 I297F probably benign Het
Gprc5a T A 6: 135,079,344 I263N possibly damaging Het
Gys2 A T 6: 142,454,451 S345T probably benign Het
Ibtk A C 9: 85,697,237 S1202A possibly damaging Het
Il23r T G 6: 67,423,981 D455A probably benign Het
Irs2 T A 8: 11,006,522 K637* probably null Het
Jak2 T C 19: 29,283,546 V314A probably benign Het
Mei1 C T 15: 82,082,623 probably benign Het
Mill1 T C 7: 18,262,466 M69T probably benign Het
Mms22l T C 4: 24,598,884 probably null Het
Mup8 C A 4: 60,220,332 Q133H probably benign Het
Mup8 T A 4: 60,220,333 Q133L probably benign Het
Mycbp2 A T 14: 103,191,619 Y2374N probably damaging Het
Nbeal1 A T 1: 60,257,450 K1166N probably damaging Het
Nlrc4 T A 17: 74,448,196 R8S probably benign Het
Nrcam C T 12: 44,549,898 Q25* probably null Het
Nudt16 A C 9: 105,131,561 M47R probably damaging Het
Nup62 T C 7: 44,828,995 S145P probably benign Het
Olfr1222 T C 2: 89,124,989 I247M possibly damaging Het
Olfr959 A G 9: 39,572,465 W265R probably benign Het
Osbpl1a A T 18: 12,933,600 V34D probably benign Het
Otogl T A 10: 107,876,921 N521Y probably damaging Het
Pcdhb14 T A 18: 37,449,834 D664E possibly damaging Het
Pex5l T C 3: 33,082,151 probably benign Het
Pkhd1 A G 1: 20,562,415 L592P probably damaging Het
Plxdc2 A G 2: 16,729,376 H480R probably benign Het
Rnf216 T A 5: 143,080,236 K532N probably damaging Het
Schip1 C A 3: 68,617,695 Q358K probably damaging Het
Sdc2 A T 15: 33,028,087 E117V possibly damaging Het
Sept11 A T 5: 93,171,464 probably null Het
Shprh A T 10: 11,162,180 E420V probably benign Het
Ska1 T A 18: 74,196,973 H232L probably benign Het
Slc36a4 A G 9: 15,719,660 N25S possibly damaging Het
Slitrk3 G A 3: 73,050,839 T200M probably damaging Het
Smad2 C T 18: 76,288,013 H138Y probably benign Het
Snx21 T C 2: 164,786,165 S34P probably damaging Het
Sos2 A G 12: 69,648,585 V126A probably damaging Het
Srcap C T 7: 127,530,794 T596I probably damaging Het
Stk31 T G 6: 49,406,943 probably null Het
Stox1 T C 10: 62,663,964 D939G probably damaging Het
Syne2 G T 12: 76,061,779 C979F possibly damaging Het
Tanc2 C A 11: 105,776,858 N88K possibly damaging Het
Tll2 A T 19: 41,096,008 V677E probably damaging Het
Ttn T C 2: 76,918,490 T4072A probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Unc13b AGAGCC AGAGCCCGAGCC 4: 43,177,330 probably benign Het
Unc13b CAGAGC CAGAGCGAGAGC 4: 43,177,341 probably benign Het
Vmn2r43 A T 7: 8,255,254 F320Y possibly damaging Het
Zscan4f G T 7: 11,401,278 G204* probably null Het
Other mutations in Hk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Hk2 APN 6 82729552 missense possibly damaging 0.93
IGL01484:Hk2 APN 6 82736730 missense probably damaging 1.00
IGL01786:Hk2 APN 6 82739553 missense probably benign 0.13
IGL02164:Hk2 APN 6 82743939 splice site probably null
IGL02293:Hk2 APN 6 82743975 missense probably benign 0.00
IGL02861:Hk2 APN 6 82760158 missense possibly damaging 0.73
IGL03029:Hk2 APN 6 82738333 missense probably damaging 1.00
IGL03063:Hk2 APN 6 82739649 missense probably damaging 1.00
IGL03063:Hk2 APN 6 82749232 missense probably benign 0.23
IGL02799:Hk2 UTSW 6 82760238 missense probably damaging 1.00
PIT4243001:Hk2 UTSW 6 82730877 missense probably damaging 1.00
R0069:Hk2 UTSW 6 82736528 critical splice donor site probably null
R0081:Hk2 UTSW 6 82734976 splice site probably benign
R0981:Hk2 UTSW 6 82743968 missense probably damaging 1.00
R1234:Hk2 UTSW 6 82760248 missense possibly damaging 0.95
R1239:Hk2 UTSW 6 82749308 missense probably damaging 1.00
R1695:Hk2 UTSW 6 82744951 missense probably damaging 0.99
R1891:Hk2 UTSW 6 82749283 missense probably benign 0.01
R2338:Hk2 UTSW 6 82731115 missense probably damaging 1.00
R3854:Hk2 UTSW 6 82736676 missense possibly damaging 0.87
R3855:Hk2 UTSW 6 82736676 missense possibly damaging 0.87
R3856:Hk2 UTSW 6 82736676 missense possibly damaging 0.87
R3887:Hk2 UTSW 6 82734961 missense possibly damaging 0.72
R4382:Hk2 UTSW 6 82735341 missense probably null 1.00
R4684:Hk2 UTSW 6 82739648 missense probably damaging 1.00
R4705:Hk2 UTSW 6 82739650 missense possibly damaging 0.95
R4735:Hk2 UTSW 6 82744974 missense probably benign 0.40
R5014:Hk2 UTSW 6 82743955 missense possibly damaging 0.73
R5552:Hk2 UTSW 6 82730823 missense possibly damaging 0.87
R5914:Hk2 UTSW 6 82736634 missense probably benign
R6212:Hk2 UTSW 6 82728842 missense probably benign 0.02
R6276:Hk2 UTSW 6 82743366 missense probably benign 0.05
R6369:Hk2 UTSW 6 82736753 missense probably damaging 1.00
R7175:Hk2 UTSW 6 82734849 missense probably benign 0.00
R7340:Hk2 UTSW 6 82728892 missense probably benign 0.00
R7383:Hk2 UTSW 6 82749295 missense probably damaging 1.00
R7417:Hk2 UTSW 6 82743345 missense probably damaging 1.00
R7481:Hk2 UTSW 6 82760169 missense probably benign 0.09
R7495:Hk2 UTSW 6 82727365 missense probably damaging 1.00
R8023:Hk2 UTSW 6 82728809 missense probably benign 0.00
R8100:Hk2 UTSW 6 82730878 missense probably benign 0.14
R8385:Hk2 UTSW 6 82729546 missense probably benign 0.03
R8504:Hk2 UTSW 6 82744866 missense possibly damaging 0.84
R8695:Hk2 UTSW 6 82739646 missense probably benign 0.02
R8808:Hk2 UTSW 6 82728766 missense probably benign 0.01
R8898:Hk2 UTSW 6 82738398 missense probably damaging 0.98
R9037:Hk2 UTSW 6 82743358 missense probably benign 0.39
R9474:Hk2 UTSW 6 82728914 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTTTGGGGATAATGCAAAGG -3'
(R):5'- TGAGGAATCTCAGCCCCTAG -3'

Sequencing Primer
(F):5'- GTGGAGACAAGCCCTTGC -3'
(R):5'- CTAGGCAGACTTCTACAAGCAGTG -3'
Posted On 2019-11-26