Incidental Mutation 'R7757:Zscan4f'
ID 597610
Institutional Source Beutler Lab
Gene Symbol Zscan4f
Ensembl Gene ENSMUSG00000070828
Gene Name zinc finger and SCAN domain containing 4F
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock # R7757 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 11397915-11402318 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 11401278 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Stop codon at position 204 (G204*)
Ref Sequence ENSEMBL: ENSMUSP00000120149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000141491] [ENSMUST00000145237]
AlphaFold Q3URS2
Predicted Effect probably benign
Transcript: ENSMUST00000141491
SMART Domains Protein: ENSMUSP00000122083
Gene: ENSMUSG00000070828

DomainStartEndE-ValueType
Pfam:SCAN 33 77 2.3e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000145237
AA Change: G204*
SMART Domains Protein: ENSMUSP00000120149
Gene: ENSMUSG00000070828
AA Change: G204*

DomainStartEndE-ValueType
Pfam:SCAN 43 122 3.7e-17 PFAM
low complexity region 181 197 N/A INTRINSIC
ZnF_C2H2 395 417 2.75e-3 SMART
ZnF_C2H2 424 446 7.68e0 SMART
ZnF_C2H2 452 474 4.17e-3 SMART
ZnF_C2H2 480 503 3.83e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A T 15: 8,252,227 E2850V unknown Het
2700049A03Rik G A 12: 71,189,413 M1179I probably benign Het
6430550D23Rik T C 2: 156,003,431 T18A possibly damaging Het
Acox2 T C 14: 8,230,166 N659S probably damaging Het
Agk T C 6: 40,376,278 V192A possibly damaging Het
Ap3b1 T A 13: 94,528,158 probably null Het
Bche T A 3: 73,701,121 D324V probably damaging Het
Bsn A G 9: 108,114,740 I1271T possibly damaging Het
Capn12 T C 7: 28,882,821 L120P probably damaging Het
Cep290 T A 10: 100,563,434 S2273T probably benign Het
Ckap4 T C 10: 84,528,467 E244G probably damaging Het
Clcn7 T C 17: 25,156,822 Y545H probably damaging Het
Cmya5 T A 13: 93,098,272 T103S possibly damaging Het
Cpne9 G A 6: 113,284,445 V121M possibly damaging Het
Csmd2 T A 4: 128,483,456 I2043N Het
Disc1 A G 8: 125,087,504 T36A probably benign Het
Disp2 T C 2: 118,790,910 Y708H probably damaging Het
Dnah3 A G 7: 120,071,570 V635A probably benign Het
Dnah3 A T 7: 119,971,215 probably null Het
Dync1li1 A G 9: 114,709,277 H234R possibly damaging Het
Egfr T C 11: 16,889,966 V660A possibly damaging Het
Epb42 T C 2: 121,027,719 R253G possibly damaging Het
Fat2 T A 11: 55,311,421 T276S probably benign Het
Fcho2 A G 13: 98,764,503 probably null Het
Ginm1 A T 10: 7,779,355 I41N probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm49368 C T 7: 128,112,226 R701C probably damaging Het
Gpr37 T A 6: 25,688,208 I297F probably benign Het
Gprc5a T A 6: 135,079,344 I263N possibly damaging Het
Gys2 A T 6: 142,454,451 S345T probably benign Het
Hk2 T C 6: 82,742,915 M255V possibly damaging Het
Ibtk A C 9: 85,697,237 S1202A possibly damaging Het
Il23r T G 6: 67,423,981 D455A probably benign Het
Irs2 T A 8: 11,006,522 K637* probably null Het
Jak2 T C 19: 29,283,546 V314A probably benign Het
Mei1 C T 15: 82,082,623 probably benign Het
Mill1 T C 7: 18,262,466 M69T probably benign Het
Mms22l T C 4: 24,598,884 probably null Het
Mup8 C A 4: 60,220,332 Q133H probably benign Het
Mup8 T A 4: 60,220,333 Q133L probably benign Het
Mycbp2 A T 14: 103,191,619 Y2374N probably damaging Het
Nbeal1 A T 1: 60,257,450 K1166N probably damaging Het
Nlrc4 T A 17: 74,448,196 R8S probably benign Het
Nrcam C T 12: 44,549,898 Q25* probably null Het
Nudt16 A C 9: 105,131,561 M47R probably damaging Het
Nup62 T C 7: 44,828,995 S145P probably benign Het
Olfr1222 T C 2: 89,124,989 I247M possibly damaging Het
Olfr959 A G 9: 39,572,465 W265R probably benign Het
Osbpl1a A T 18: 12,933,600 V34D probably benign Het
Otogl T A 10: 107,876,921 N521Y probably damaging Het
Pcdhb14 T A 18: 37,449,834 D664E possibly damaging Het
Pex5l T C 3: 33,082,151 probably benign Het
Pkhd1 A G 1: 20,562,415 L592P probably damaging Het
Plxdc2 A G 2: 16,729,376 H480R probably benign Het
Rnf216 T A 5: 143,080,236 K532N probably damaging Het
Schip1 C A 3: 68,617,695 Q358K probably damaging Het
Sdc2 A T 15: 33,028,087 E117V possibly damaging Het
Sept11 A T 5: 93,171,464 probably null Het
Shprh A T 10: 11,162,180 E420V probably benign Het
Ska1 T A 18: 74,196,973 H232L probably benign Het
Slc36a4 A G 9: 15,719,660 N25S possibly damaging Het
Slitrk3 G A 3: 73,050,839 T200M probably damaging Het
Smad2 C T 18: 76,288,013 H138Y probably benign Het
Snx21 T C 2: 164,786,165 S34P probably damaging Het
Sos2 A G 12: 69,648,585 V126A probably damaging Het
Srcap C T 7: 127,530,794 T596I probably damaging Het
Stk31 T G 6: 49,406,943 probably null Het
Stox1 T C 10: 62,663,964 D939G probably damaging Het
Syne2 G T 12: 76,061,779 C979F possibly damaging Het
Tanc2 C A 11: 105,776,858 N88K possibly damaging Het
Tll2 A T 19: 41,096,008 V677E probably damaging Het
Ttn T C 2: 76,918,490 T4072A probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Unc13b AGAGCC AGAGCCCGAGCC 4: 43,177,330 probably benign Het
Unc13b CAGAGC CAGAGCGAGAGC 4: 43,177,341 probably benign Het
Vmn2r43 A T 7: 8,255,254 F320Y possibly damaging Het
Other mutations in Zscan4f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03253:Zscan4f APN 7 11401343 missense probably benign 0.07
R1719:Zscan4f UTSW 7 11401327 missense possibly damaging 0.94
R4094:Zscan4f UTSW 7 11401258 missense probably damaging 1.00
R7602:Zscan4f UTSW 7 11401381 missense possibly damaging 0.79
R8030:Zscan4f UTSW 7 11401363 missense probably benign 0.01
R8094:Zscan4f UTSW 7 11401227 missense possibly damaging 0.86
R8280:Zscan4f UTSW 7 11517672 missense probably damaging 0.99
R9153:Zscan4f UTSW 7 11401314 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ATTGGCCACAGGTTAGTTGG -3'
(R):5'- ACTTGAGTAGCTGCATTTCTGG -3'

Sequencing Primer
(F):5'- GGGGTCCATTTTGGATACAT -3'
(R):5'- AGCAATTGTTCTTGTCCTCAGAG -3'
Posted On 2019-11-26