Incidental Mutation 'R7757:Mill1'
ID 597611
Institutional Source Beutler Lab
Gene Symbol Mill1
Ensembl Gene ENSMUSG00000054005
Gene Name MHC I like leukocyte 1
Synonyms 5530400I18Rik
MMRRC Submission 045813-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R7757 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 18245347-18266092 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18262466 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 69 (M69T)
Ref Sequence ENSEMBL: ENSMUSP00000069083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066780]
AlphaFold Q8HWE7
Predicted Effect probably benign
Transcript: ENSMUST00000066780
AA Change: M69T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000069083
Gene: ENSMUSG00000054005
AA Change: M69T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:MHC_I 60 236 3.8e-33 PFAM
IGc1 255 327 3.53e-4 SMART
Meta Mutation Damage Score 0.0697 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A T 15: 8,252,227 (GRCm38) E2850V unknown Het
2700049A03Rik G A 12: 71,189,413 (GRCm38) M1179I probably benign Het
6430550D23Rik T C 2: 156,003,431 (GRCm38) T18A possibly damaging Het
Acox2 T C 14: 8,230,166 (GRCm38) N659S probably damaging Het
Agk T C 6: 40,376,278 (GRCm38) V192A possibly damaging Het
Ap3b1 T A 13: 94,528,158 (GRCm38) probably null Het
Bche T A 3: 73,701,121 (GRCm38) D324V probably damaging Het
Bsn A G 9: 108,114,740 (GRCm38) I1271T possibly damaging Het
Capn12 T C 7: 28,882,821 (GRCm38) L120P probably damaging Het
Cep290 T A 10: 100,563,434 (GRCm38) S2273T probably benign Het
Ckap4 T C 10: 84,528,467 (GRCm38) E244G probably damaging Het
Clcn7 T C 17: 25,156,822 (GRCm38) Y545H probably damaging Het
Cmya5 T A 13: 93,098,272 (GRCm38) T103S possibly damaging Het
Cpne9 G A 6: 113,284,445 (GRCm38) V121M possibly damaging Het
Csmd2 T A 4: 128,483,456 (GRCm38) I2043N Het
Disc1 A G 8: 125,087,504 (GRCm38) T36A probably benign Het
Disp2 T C 2: 118,790,910 (GRCm38) Y708H probably damaging Het
Dnah3 A G 7: 120,071,570 (GRCm38) V635A probably benign Het
Dnah3 A T 7: 119,971,215 (GRCm38) probably null Het
Dync1li1 A G 9: 114,709,277 (GRCm38) H234R possibly damaging Het
Egfr T C 11: 16,889,966 (GRCm38) V660A possibly damaging Het
Epb42 T C 2: 121,027,719 (GRCm38) R253G possibly damaging Het
Fat2 T A 11: 55,311,421 (GRCm38) T276S probably benign Het
Fcho2 A G 13: 98,764,503 (GRCm38) probably null Het
Ginm1 A T 10: 7,779,355 (GRCm38) I41N probably damaging Het
Gm4744 A G 6: 40,950,433 (GRCm38) probably benign Het
Gm49368 C T 7: 128,112,226 (GRCm38) R701C probably damaging Het
Gpr37 T A 6: 25,688,208 (GRCm38) I297F probably benign Het
Gprc5a T A 6: 135,079,344 (GRCm38) I263N possibly damaging Het
Gys2 A T 6: 142,454,451 (GRCm38) S345T probably benign Het
Hk2 T C 6: 82,742,915 (GRCm38) M255V possibly damaging Het
Ibtk A C 9: 85,697,237 (GRCm38) S1202A possibly damaging Het
Il23r T G 6: 67,423,981 (GRCm38) D455A probably benign Het
Irs2 T A 8: 11,006,522 (GRCm38) K637* probably null Het
Jak2 T C 19: 29,283,546 (GRCm38) V314A probably benign Het
Mei1 C T 15: 82,082,623 (GRCm38) probably benign Het
Mms22l T C 4: 24,598,884 (GRCm38) probably null Het
Mup8 C A 4: 60,220,332 (GRCm38) Q133H probably benign Het
Mup8 T A 4: 60,220,333 (GRCm38) Q133L probably benign Het
Mycbp2 A T 14: 103,191,619 (GRCm38) Y2374N probably damaging Het
Nbeal1 A T 1: 60,257,450 (GRCm38) K1166N probably damaging Het
Nlrc4 T A 17: 74,448,196 (GRCm38) R8S probably benign Het
Nrcam C T 12: 44,549,898 (GRCm38) Q25* probably null Het
Nudt16 A C 9: 105,131,561 (GRCm38) M47R probably damaging Het
Nup62 T C 7: 44,828,995 (GRCm38) S145P probably benign Het
Olfr1222 T C 2: 89,124,989 (GRCm38) I247M possibly damaging Het
Olfr959 A G 9: 39,572,465 (GRCm38) W265R probably benign Het
Osbpl1a A T 18: 12,933,600 (GRCm38) V34D probably benign Het
Otogl T A 10: 107,876,921 (GRCm38) N521Y probably damaging Het
Pcdhb14 T A 18: 37,449,834 (GRCm38) D664E possibly damaging Het
Pex5l T C 3: 33,082,151 (GRCm38) probably benign Het
Pkhd1 A G 1: 20,562,415 (GRCm38) L592P probably damaging Het
Plxdc2 A G 2: 16,729,376 (GRCm38) H480R probably benign Het
Rnf216 T A 5: 143,080,236 (GRCm38) K532N probably damaging Het
Schip1 C A 3: 68,617,695 (GRCm38) Q358K probably damaging Het
Sdc2 A T 15: 33,028,087 (GRCm38) E117V possibly damaging Het
Sept11 A T 5: 93,171,464 (GRCm38) probably null Het
Shprh A T 10: 11,162,180 (GRCm38) E420V probably benign Het
Ska1 T A 18: 74,196,973 (GRCm38) H232L probably benign Het
Slc36a4 A G 9: 15,719,660 (GRCm38) N25S possibly damaging Het
Slitrk3 G A 3: 73,050,839 (GRCm38) T200M probably damaging Het
Smad2 C T 18: 76,288,013 (GRCm38) H138Y probably benign Het
Snx21 T C 2: 164,786,165 (GRCm38) S34P probably damaging Het
Sos2 A G 12: 69,648,585 (GRCm38) V126A probably damaging Het
Srcap C T 7: 127,530,794 (GRCm38) T596I probably damaging Het
Stk31 T G 6: 49,406,943 (GRCm38) probably null Het
Stox1 T C 10: 62,663,964 (GRCm38) D939G probably damaging Het
Syne2 G T 12: 76,061,779 (GRCm38) C979F possibly damaging Het
Tanc2 C A 11: 105,776,858 (GRCm38) N88K possibly damaging Het
Tll2 A T 19: 41,096,008 (GRCm38) V677E probably damaging Het
Ttn T C 2: 76,918,490 (GRCm38) T4072A probably benign Het
Unc13b CAGAGC CAGAGCGAGAGC 4: 43,177,341 (GRCm38) probably benign Het
Unc13b AGAGCC AGAGCCCGAGCC 4: 43,177,330 (GRCm38) probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 (GRCm38) probably benign Het
Vmn2r43 A T 7: 8,255,254 (GRCm38) F320Y possibly damaging Het
Zscan4f G T 7: 11,401,278 (GRCm38) G204* probably null Het
Other mutations in Mill1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Mill1 APN 7 18,264,641 (GRCm38) missense possibly damaging 0.91
IGL01313:Mill1 APN 7 18,264,633 (GRCm38) missense possibly damaging 0.82
IGL01417:Mill1 APN 7 18,264,783 (GRCm38) missense probably benign 0.18
IGL01997:Mill1 APN 7 18,255,889 (GRCm38) missense probably damaging 1.00
IGL02282:Mill1 APN 7 18,263,204 (GRCm38) critical splice donor site probably null
IGL03126:Mill1 APN 7 18,255,907 (GRCm38) missense probably benign 0.33
IGL03197:Mill1 APN 7 18,264,665 (GRCm38) missense probably benign 0.02
R0513:Mill1 UTSW 7 18,264,877 (GRCm38) nonsense probably null
R0515:Mill1 UTSW 7 18,264,873 (GRCm38) missense probably benign 0.12
R1460:Mill1 UTSW 7 18,262,670 (GRCm38) missense probably damaging 1.00
R1589:Mill1 UTSW 7 18,245,647 (GRCm38) missense probably benign 0.01
R2192:Mill1 UTSW 7 18,264,619 (GRCm38) nonsense probably null
R3704:Mill1 UTSW 7 18,263,053 (GRCm38) missense possibly damaging 0.91
R3758:Mill1 UTSW 7 18,262,703 (GRCm38) critical splice donor site probably null
R4685:Mill1 UTSW 7 18,255,928 (GRCm38) missense probably damaging 0.98
R4753:Mill1 UTSW 7 18,262,547 (GRCm38) missense probably benign 0.28
R5763:Mill1 UTSW 7 18,245,662 (GRCm38) missense probably benign 0.03
R5938:Mill1 UTSW 7 18,262,688 (GRCm38) missense probably benign 0.00
R8094:Mill1 UTSW 7 18,255,910 (GRCm38) missense probably benign 0.01
R8972:Mill1 UTSW 7 18,263,057 (GRCm38) missense probably benign 0.00
R9620:Mill1 UTSW 7 18,263,102 (GRCm38) missense probably benign 0.01
R9694:Mill1 UTSW 7 18,263,102 (GRCm38) missense probably benign 0.01
Z1176:Mill1 UTSW 7 18,245,499 (GRCm38) start gained probably benign
Predicted Primers PCR Primer
(F):5'- ATTGACACTCATGGAGGCC -3'
(R):5'- CAGCTAGCATCCCTTTGAGTTG -3'

Sequencing Primer
(F):5'- TGGAGGCCCATGTCCTCTG -3'
(R):5'- AGCATCCCTTTGAGTTGCTCCTC -3'
Posted On 2019-11-26