Incidental Mutation 'R7757:Nup62'
ID 597613
Institutional Source Beutler Lab
Gene Symbol Nup62
Ensembl Gene ENSMUSG00000109511
Gene Name nucleoporin 62
Synonyms D7Ertd649e, p62, Nupc1
MMRRC Submission 045813-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7757 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 44465512-44480236 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44478419 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 145 (S145P)
Ref Sequence ENSEMBL: ENSMUSP00000056785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057195] [ENSMUST00000118125] [ENSMUST00000207085] [ENSMUST00000207103] [ENSMUST00000208172] [ENSMUST00000208626]
AlphaFold Q63850
Predicted Effect probably benign
Transcript: ENSMUST00000057195
AA Change: S145P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000056785
Gene: ENSMUSG00000109511
AA Change: S145P

DomainStartEndE-ValueType
low complexity region 3 81 N/A INTRINSIC
low complexity region 102 112 N/A INTRINSIC
low complexity region 143 166 N/A INTRINSIC
low complexity region 199 251 N/A INTRINSIC
low complexity region 262 296 N/A INTRINSIC
Pfam:Nsp1_C 317 433 2.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118125
SMART Domains Protein: ENSMUSP00000113726
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:AlaDh_PNT_C 47 111 6.6e-9 PFAM
Pfam:Pyr_redox_2 47 111 2e-9 PFAM
Pfam:HI0933_like 67 169 1.8e-8 PFAM
Pfam:FAD_binding_2 68 108 5e-8 PFAM
Pfam:Pyr_redox 68 109 8.5e-8 PFAM
Pfam:DAO 68 159 5.6e-8 PFAM
Pfam:NAD_binding_8 71 138 1.2e-15 PFAM
Pfam:Amino_oxidase 76 511 5.9e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207085
Predicted Effect probably benign
Transcript: ENSMUST00000207103
AA Change: S145P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000208172
AA Change: S145P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000208626
AA Change: S145P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a member of the FG-repeat containing nucleoporins and is localized to the nuclear pore central plug. This protein associates with the importin alpha/beta complex which is involved in the import of proteins containing nuclear localization signals. Multiple transcript variants of this gene encode a single protein isoform. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,236,187 (GRCm39) M1179I probably benign Het
6430550D23Rik T C 2: 155,845,351 (GRCm39) T18A possibly damaging Het
Acox2 T C 14: 8,230,166 (GRCm38) N659S probably damaging Het
Agk T C 6: 40,353,212 (GRCm39) V192A possibly damaging Het
Ap3b1 T A 13: 94,664,666 (GRCm39) probably null Het
Bche T A 3: 73,608,454 (GRCm39) D324V probably damaging Het
Bsn A G 9: 107,991,939 (GRCm39) I1271T possibly damaging Het
Capn12 T C 7: 28,582,246 (GRCm39) L120P probably damaging Het
Cep290 T A 10: 100,399,296 (GRCm39) S2273T probably benign Het
Ckap4 T C 10: 84,364,331 (GRCm39) E244G probably damaging Het
Clcn7 T C 17: 25,375,796 (GRCm39) Y545H probably damaging Het
Cmya5 T A 13: 93,234,780 (GRCm39) T103S possibly damaging Het
Cplane1 A T 15: 8,281,711 (GRCm39) E2850V unknown Het
Cpne9 G A 6: 113,261,406 (GRCm39) V121M possibly damaging Het
Csmd2 T A 4: 128,377,249 (GRCm39) I2043N Het
Disc1 A G 8: 125,814,243 (GRCm39) T36A probably benign Het
Disp2 T C 2: 118,621,391 (GRCm39) Y708H probably damaging Het
Dnah3 A G 7: 119,670,793 (GRCm39) V635A probably benign Het
Dnah3 A T 7: 119,570,438 (GRCm39) probably null Het
Dync1li1 A G 9: 114,538,345 (GRCm39) H234R possibly damaging Het
Egfr T C 11: 16,839,966 (GRCm39) V660A possibly damaging Het
Epb42 T C 2: 120,858,200 (GRCm39) R253G possibly damaging Het
Fat2 T A 11: 55,202,247 (GRCm39) T276S probably benign Het
Fcho2 A G 13: 98,901,011 (GRCm39) probably null Het
Ginm1 A T 10: 7,655,119 (GRCm39) I41N probably damaging Het
Gm4744 A G 6: 40,927,367 (GRCm39) probably benign Het
Gm49368 C T 7: 127,711,398 (GRCm39) R701C probably damaging Het
Gpr37 T A 6: 25,688,207 (GRCm39) I297F probably benign Het
Gprc5a T A 6: 135,056,342 (GRCm39) I263N possibly damaging Het
Gys2 A T 6: 142,400,177 (GRCm39) S345T probably benign Het
Hk2 T C 6: 82,719,896 (GRCm39) M255V possibly damaging Het
Ibtk A C 9: 85,579,290 (GRCm39) S1202A possibly damaging Het
Il23r T G 6: 67,400,965 (GRCm39) D455A probably benign Het
Irs2 T A 8: 11,056,522 (GRCm39) K637* probably null Het
Jak2 T C 19: 29,260,946 (GRCm39) V314A probably benign Het
Mei1 C T 15: 81,966,824 (GRCm39) probably benign Het
Mill1 T C 7: 17,996,391 (GRCm39) M69T probably benign Het
Mms22l T C 4: 24,598,884 (GRCm39) probably null Het
Mup8 C A 4: 60,220,332 (GRCm39) Q133H probably benign Het
Mup8 T A 4: 60,220,333 (GRCm39) Q133L probably benign Het
Mycbp2 A T 14: 103,429,055 (GRCm39) Y2374N probably damaging Het
Nbeal1 A T 1: 60,296,609 (GRCm39) K1166N probably damaging Het
Nlrc4 T A 17: 74,755,191 (GRCm39) R8S probably benign Het
Nrcam C T 12: 44,596,681 (GRCm39) Q25* probably null Het
Nudt16 A C 9: 105,008,760 (GRCm39) M47R probably damaging Het
Or10d1 A G 9: 39,483,761 (GRCm39) W265R probably benign Het
Or4c117 T C 2: 88,955,333 (GRCm39) I247M possibly damaging Het
Osbpl1a A T 18: 13,066,657 (GRCm39) V34D probably benign Het
Otogl T A 10: 107,712,782 (GRCm39) N521Y probably damaging Het
Pcdhb14 T A 18: 37,582,887 (GRCm39) D664E possibly damaging Het
Pex5l T C 3: 33,136,300 (GRCm39) probably benign Het
Pkhd1 A G 1: 20,632,639 (GRCm39) L592P probably damaging Het
Plxdc2 A G 2: 16,734,187 (GRCm39) H480R probably benign Het
Rnf216 T A 5: 143,065,991 (GRCm39) K532N probably damaging Het
Schip1 C A 3: 68,525,028 (GRCm39) Q358K probably damaging Het
Sdc2 A T 15: 33,028,233 (GRCm39) E117V possibly damaging Het
Septin11 A T 5: 93,319,323 (GRCm39) probably null Het
Shprh A T 10: 11,037,924 (GRCm39) E420V probably benign Het
Ska1 T A 18: 74,330,044 (GRCm39) H232L probably benign Het
Slc36a4 A G 9: 15,630,956 (GRCm39) N25S possibly damaging Het
Slitrk3 G A 3: 72,958,172 (GRCm39) T200M probably damaging Het
Smad2 C T 18: 76,421,084 (GRCm39) H138Y probably benign Het
Snx21 T C 2: 164,628,085 (GRCm39) S34P probably damaging Het
Sos2 A G 12: 69,695,359 (GRCm39) V126A probably damaging Het
Srcap C T 7: 127,129,966 (GRCm39) T596I probably damaging Het
Stk31 T G 6: 49,383,877 (GRCm39) probably null Het
Stox1 T C 10: 62,499,743 (GRCm39) D939G probably damaging Het
Syne2 G T 12: 76,108,553 (GRCm39) C979F possibly damaging Het
Tanc2 C A 11: 105,667,684 (GRCm39) N88K possibly damaging Het
Tll2 A T 19: 41,084,447 (GRCm39) V677E probably damaging Het
Ttn T C 2: 76,748,834 (GRCm39) T4072A probably benign Het
Unc13b CAGAGC CAGAGCGAGAGC 4: 43,177,341 (GRCm39) probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 (GRCm39) probably benign Het
Unc13b AGAGCC AGAGCCCGAGCC 4: 43,177,330 (GRCm39) probably benign Het
Vmn2r43 A T 7: 8,258,253 (GRCm39) F320Y possibly damaging Het
Zscan4f G T 7: 11,135,205 (GRCm39) G204* probably null Het
Other mutations in Nup62
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1542:Nup62 UTSW 7 44,479,353 (GRCm39) missense possibly damaging 0.53
R1867:Nup62 UTSW 7 44,478,472 (GRCm39) missense possibly damaging 0.92
R1868:Nup62 UTSW 7 44,478,472 (GRCm39) missense possibly damaging 0.92
R2100:Nup62 UTSW 7 44,478,921 (GRCm39) unclassified probably benign
R4884:Nup62 UTSW 7 44,478,289 (GRCm39) missense probably damaging 0.99
R4977:Nup62 UTSW 7 44,478,449 (GRCm39) missense possibly damaging 0.92
R5808:Nup62 UTSW 7 44,479,416 (GRCm39) missense possibly damaging 0.53
R6052:Nup62 UTSW 7 44,478,464 (GRCm39) missense possibly damaging 0.93
R6895:Nup62 UTSW 7 44,479,157 (GRCm39) missense possibly damaging 0.71
R8322:Nup62 UTSW 7 44,478,440 (GRCm39) missense possibly damaging 0.92
X0026:Nup62 UTSW 7 44,478,398 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCTGGAGGAACAGGCTTCTC -3'
(R):5'- GCAAAGAGTGTAGACCCTGC -3'

Sequencing Primer
(F):5'- TTCTCCCTGGGGATCAGCAC -3'
(R):5'- TGTAGACCCTGCACTGGTG -3'
Posted On 2019-11-26