Incidental Mutation 'R7757:Nup62'
ID597613
Institutional Source Beutler Lab
Gene Symbol Nup62
Ensembl Gene ENSMUSG00000109511
Gene Namenucleoporin 62
SynonymsNupc1, p62, D7Ertd649e
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7757 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location44816088-44830812 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44828995 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 145 (S145P)
Ref Sequence ENSEMBL: ENSMUSP00000056785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057195] [ENSMUST00000118125] [ENSMUST00000207085] [ENSMUST00000207103] [ENSMUST00000208172] [ENSMUST00000208626]
Predicted Effect probably benign
Transcript: ENSMUST00000057195
AA Change: S145P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000056785
Gene: ENSMUSG00000109511
AA Change: S145P

DomainStartEndE-ValueType
low complexity region 3 81 N/A INTRINSIC
low complexity region 102 112 N/A INTRINSIC
low complexity region 143 166 N/A INTRINSIC
low complexity region 199 251 N/A INTRINSIC
low complexity region 262 296 N/A INTRINSIC
Pfam:Nsp1_C 317 433 2.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118125
SMART Domains Protein: ENSMUSP00000113726
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:AlaDh_PNT_C 47 111 6.6e-9 PFAM
Pfam:Pyr_redox_2 47 111 2e-9 PFAM
Pfam:HI0933_like 67 169 1.8e-8 PFAM
Pfam:FAD_binding_2 68 108 5e-8 PFAM
Pfam:Pyr_redox 68 109 8.5e-8 PFAM
Pfam:DAO 68 159 5.6e-8 PFAM
Pfam:NAD_binding_8 71 138 1.2e-15 PFAM
Pfam:Amino_oxidase 76 511 5.9e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207085
Predicted Effect probably benign
Transcript: ENSMUST00000207103
AA Change: S145P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000208172
AA Change: S145P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000208626
AA Change: S145P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a member of the FG-repeat containing nucleoporins and is localized to the nuclear pore central plug. This protein associates with the importin alpha/beta complex which is involved in the import of proteins containing nuclear localization signals. Multiple transcript variants of this gene encode a single protein isoform. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A T 15: 8,252,227 E2850V unknown Het
2700049A03Rik G A 12: 71,189,413 M1179I probably benign Het
6430550D23Rik T C 2: 156,003,431 T18A possibly damaging Het
Acox2 T C 14: 8,230,166 N659S probably damaging Het
Agk T C 6: 40,376,278 V192A possibly damaging Het
Bche T A 3: 73,701,121 D324V probably damaging Het
Bsn A G 9: 108,114,740 I1271T possibly damaging Het
Capn12 T C 7: 28,882,821 L120P probably damaging Het
Cep290 T A 10: 100,563,434 S2273T probably benign Het
Ckap4 T C 10: 84,528,467 E244G probably damaging Het
Clcn7 T C 17: 25,156,822 Y545H probably damaging Het
Cmya5 T A 13: 93,098,272 T103S possibly damaging Het
Cpne9 G A 6: 113,284,445 V121M possibly damaging Het
Csmd2 T A 4: 128,483,456 I2043N Het
Disc1 A G 8: 125,087,504 T36A probably benign Het
Disp2 T C 2: 118,790,910 Y708H probably damaging Het
Dnah3 A G 7: 120,071,570 V635A probably benign Het
Dync1li1 A G 9: 114,709,277 H234R possibly damaging Het
Egfr T C 11: 16,889,966 V660A possibly damaging Het
Epb42 T C 2: 121,027,719 R253G possibly damaging Het
Fat2 T A 11: 55,311,421 T276S probably benign Het
Fcho2 A G 13: 98,764,503 probably null Het
Ginm1 A T 10: 7,779,355 I41N probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm49368 C T 7: 128,112,226 R701C probably damaging Het
Gpr37 T A 6: 25,688,208 I297F probably benign Het
Gprc5a T A 6: 135,079,344 I263N possibly damaging Het
Gys2 A T 6: 142,454,451 S345T probably benign Het
Hk2 T C 6: 82,742,915 M255V possibly damaging Het
Ibtk A C 9: 85,697,237 S1202A possibly damaging Het
Il23r T G 6: 67,423,981 D455A probably benign Het
Irs2 T A 8: 11,006,522 K637* probably null Het
Jak2 T C 19: 29,283,546 V314A probably benign Het
Mei1 C T 15: 82,082,623 probably benign Het
Mill1 T C 7: 18,262,466 M69T probably benign Het
Mms22l T C 4: 24,598,884 probably null Het
Mup8 C A 4: 60,220,332 Q133H probably benign Het
Mup8 T A 4: 60,220,333 Q133L probably benign Het
Mycbp2 A T 14: 103,191,619 Y2374N probably damaging Het
Nbeal1 A T 1: 60,257,450 K1166N probably damaging Het
Nlrc4 T A 17: 74,448,196 R8S probably benign Het
Nudt16 A C 9: 105,131,561 M47R probably damaging Het
Olfr1222 T C 2: 89,124,989 I247M possibly damaging Het
Olfr959 A G 9: 39,572,465 W265R probably benign Het
Osbpl1a A T 18: 12,933,600 V34D probably benign Het
Otogl T A 10: 107,876,921 N521Y probably damaging Het
Pcdhb14 T A 18: 37,449,834 D664E possibly damaging Het
Pex5l T C 3: 33,082,151 probably benign Het
Pkhd1 A G 1: 20,562,415 L592P probably damaging Het
Plxdc2 A G 2: 16,729,376 H480R probably benign Het
Rnf216 T A 5: 143,080,236 K532N probably damaging Het
Schip1 C A 3: 68,617,695 Q358K probably damaging Het
Sdc2 A T 15: 33,028,087 E117V possibly damaging Het
Shprh A T 10: 11,162,180 E420V probably benign Het
Ska1 T A 18: 74,196,973 H232L probably benign Het
Slc36a4 A G 9: 15,719,660 N25S possibly damaging Het
Slitrk3 G A 3: 73,050,839 T200M probably damaging Het
Smad2 C T 18: 76,288,013 H138Y probably benign Het
Snx21 T C 2: 164,786,165 S34P probably damaging Het
Sos2 A G 12: 69,648,585 V126A probably damaging Het
Srcap C T 7: 127,530,794 T596I probably damaging Het
Stox1 T C 10: 62,663,964 D939G probably damaging Het
Syne2 G T 12: 76,061,779 C979F possibly damaging Het
Tanc2 C A 11: 105,776,858 N88K possibly damaging Het
Tll2 A T 19: 41,096,008 V677E probably damaging Het
Ttn T C 2: 76,918,490 T4072A probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Unc13b AGAGCC AGAGCCCGAGCC 4: 43,177,330 probably benign Het
Unc13b CAGAGC CAGAGCGAGAGC 4: 43,177,341 probably benign Het
Vmn2r43 A T 7: 8,255,254 F320Y possibly damaging Het
Zscan4f G T 7: 11,401,278 G204* probably null Het
Other mutations in Nup62
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1542:Nup62 UTSW 7 44829929 missense possibly damaging 0.53
R1867:Nup62 UTSW 7 44829048 missense possibly damaging 0.92
R1868:Nup62 UTSW 7 44829048 missense possibly damaging 0.92
R2100:Nup62 UTSW 7 44829497 unclassified probably benign
R4884:Nup62 UTSW 7 44828865 missense probably damaging 0.99
R4977:Nup62 UTSW 7 44829025 missense possibly damaging 0.92
R5808:Nup62 UTSW 7 44829992 missense possibly damaging 0.53
R6052:Nup62 UTSW 7 44829040 missense possibly damaging 0.93
R6895:Nup62 UTSW 7 44829733 missense possibly damaging 0.71
X0026:Nup62 UTSW 7 44828974 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCTGGAGGAACAGGCTTCTC -3'
(R):5'- GCAAAGAGTGTAGACCCTGC -3'

Sequencing Primer
(F):5'- TTCTCCCTGGGGATCAGCAC -3'
(R):5'- TGTAGACCCTGCACTGGTG -3'
Posted On2019-11-26