Incidental Mutation 'R7757:Srcap'
ID 597615
Institutional Source Beutler Lab
Gene Symbol Srcap
Ensembl Gene ENSMUSG00000053877
Gene Name Snf2-related CREBBP activator protein
Synonyms D030022P06Rik, F630004O05Rik, B930091H02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R7757 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 127511983-127561219 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 127530794 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 596 (T596I)
Ref Sequence ENSEMBL: ENSMUSP00000063817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066582] [ENSMUST00000186672] [ENSMUST00000186954] [ENSMUST00000187040] [ENSMUST00000188124] [ENSMUST00000189629] [ENSMUST00000190390]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000066582
AA Change: T596I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063817
Gene: ENSMUSG00000053877
AA Change: T596I

DomainStartEndE-ValueType
Pfam:HSA 108 177 1.1e-22 PFAM
low complexity region 238 261 N/A INTRINSIC
low complexity region 264 291 N/A INTRINSIC
low complexity region 303 328 N/A INTRINSIC
low complexity region 377 400 N/A INTRINSIC
low complexity region 460 538 N/A INTRINSIC
low complexity region 557 572 N/A INTRINSIC
DEXDc 606 798 1.22e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186672
AA Change: T616I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140395
Gene: ENSMUSG00000053877
AA Change: T616I

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 420 N/A INTRINSIC
low complexity region 480 558 N/A INTRINSIC
low complexity region 577 592 N/A INTRINSIC
DEXDc 626 818 5e-37 SMART
low complexity region 993 1001 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
low complexity region 1150 1178 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186954
AA Change: T616I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139536
Gene: ENSMUSG00000053877
AA Change: T616I

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 420 N/A INTRINSIC
low complexity region 480 558 N/A INTRINSIC
low complexity region 577 592 N/A INTRINSIC
DEXDc 626 818 5e-37 SMART
low complexity region 993 1001 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
low complexity region 1175 1194 N/A INTRINSIC
internal_repeat_1 1202 1245 2.24e-5 PROSPERO
low complexity region 1274 1302 N/A INTRINSIC
low complexity region 1304 1318 N/A INTRINSIC
low complexity region 1335 1353 N/A INTRINSIC
low complexity region 1355 1370 N/A INTRINSIC
low complexity region 1414 1441 N/A INTRINSIC
low complexity region 1452 1466 N/A INTRINSIC
low complexity region 1504 1533 N/A INTRINSIC
internal_repeat_1 1536 1579 2.24e-5 PROSPERO
internal_repeat_2 1537 1559 5.66e-5 PROSPERO
internal_repeat_2 1569 1589 5.66e-5 PROSPERO
low complexity region 1590 1607 N/A INTRINSIC
low complexity region 1609 1627 N/A INTRINSIC
low complexity region 1644 1678 N/A INTRINSIC
low complexity region 1713 1726 N/A INTRINSIC
low complexity region 1828 1840 N/A INTRINSIC
HELICc 1916 1999 1.2e-28 SMART
low complexity region 2058 2078 N/A INTRINSIC
coiled coil region 2166 2201 N/A INTRINSIC
low complexity region 2282 2348 N/A INTRINSIC
low complexity region 2374 2409 N/A INTRINSIC
low complexity region 2588 2600 N/A INTRINSIC
low complexity region 2642 2657 N/A INTRINSIC
low complexity region 2685 2712 N/A INTRINSIC
AT_hook 2745 2757 2.4e-2 SMART
low complexity region 2797 2817 N/A INTRINSIC
AT_hook 2825 2837 2.6e-3 SMART
low complexity region 2838 2849 N/A INTRINSIC
low complexity region 2858 2885 N/A INTRINSIC
AT_hook 2889 2901 2.4e-3 SMART
low complexity region 2934 2945 N/A INTRINSIC
low complexity region 2946 2956 N/A INTRINSIC
low complexity region 3043 3079 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187040
AA Change: T616I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140036
Gene: ENSMUSG00000053877
AA Change: T616I

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 420 N/A INTRINSIC
low complexity region 480 558 N/A INTRINSIC
low complexity region 577 592 N/A INTRINSIC
DEXDc 626 818 5e-37 SMART
low complexity region 993 1001 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
low complexity region 1150 1178 N/A INTRINSIC
low complexity region 1277 1305 N/A INTRINSIC
low complexity region 1332 1351 N/A INTRINSIC
internal_repeat_1 1359 1402 1.78e-5 PROSPERO
low complexity region 1431 1459 N/A INTRINSIC
low complexity region 1461 1475 N/A INTRINSIC
low complexity region 1492 1510 N/A INTRINSIC
low complexity region 1512 1527 N/A INTRINSIC
low complexity region 1571 1598 N/A INTRINSIC
low complexity region 1609 1623 N/A INTRINSIC
low complexity region 1661 1690 N/A INTRINSIC
internal_repeat_1 1693 1736 1.78e-5 PROSPERO
internal_repeat_2 1694 1716 4.56e-5 PROSPERO
internal_repeat_2 1726 1746 4.56e-5 PROSPERO
low complexity region 1747 1764 N/A INTRINSIC
low complexity region 1766 1784 N/A INTRINSIC
low complexity region 1801 1835 N/A INTRINSIC
low complexity region 1870 1883 N/A INTRINSIC
low complexity region 1985 1997 N/A INTRINSIC
HELICc 2073 2156 1.2e-28 SMART
low complexity region 2215 2235 N/A INTRINSIC
coiled coil region 2323 2358 N/A INTRINSIC
low complexity region 2439 2505 N/A INTRINSIC
low complexity region 2531 2566 N/A INTRINSIC
low complexity region 2745 2757 N/A INTRINSIC
low complexity region 2799 2814 N/A INTRINSIC
low complexity region 2842 2869 N/A INTRINSIC
AT_hook 2902 2914 2.4e-2 SMART
low complexity region 2954 2974 N/A INTRINSIC
AT_hook 2982 2994 2.6e-3 SMART
low complexity region 2995 3006 N/A INTRINSIC
low complexity region 3015 3042 N/A INTRINSIC
AT_hook 3046 3058 2.4e-3 SMART
low complexity region 3091 3102 N/A INTRINSIC
low complexity region 3103 3113 N/A INTRINSIC
low complexity region 3200 3236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188124
SMART Domains Protein: ENSMUSP00000140882
Gene: ENSMUSG00000053877

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189629
AA Change: T597I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139644
Gene: ENSMUSG00000107023
AA Change: T597I

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
HSA 106 177 5.4e-25 SMART
low complexity region 238 261 N/A INTRINSIC
low complexity region 264 291 N/A INTRINSIC
low complexity region 303 328 N/A INTRINSIC
low complexity region 377 401 N/A INTRINSIC
low complexity region 461 539 N/A INTRINSIC
low complexity region 558 573 N/A INTRINSIC
DEXDc 607 799 5e-37 SMART
low complexity region 974 982 N/A INTRINSIC
low complexity region 1008 1023 N/A INTRINSIC
low complexity region 1027 1044 N/A INTRINSIC
low complexity region 1156 1175 N/A INTRINSIC
internal_repeat_1 1183 1226 2e-5 PROSPERO
low complexity region 1255 1283 N/A INTRINSIC
low complexity region 1285 1299 N/A INTRINSIC
low complexity region 1316 1334 N/A INTRINSIC
low complexity region 1336 1351 N/A INTRINSIC
low complexity region 1395 1422 N/A INTRINSIC
low complexity region 1433 1447 N/A INTRINSIC
low complexity region 1485 1514 N/A INTRINSIC
internal_repeat_1 1517 1560 2e-5 PROSPERO
internal_repeat_2 1518 1540 5.08e-5 PROSPERO
internal_repeat_2 1550 1570 5.08e-5 PROSPERO
low complexity region 1571 1588 N/A INTRINSIC
low complexity region 1590 1608 N/A INTRINSIC
low complexity region 1625 1659 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
low complexity region 1809 1821 N/A INTRINSIC
HELICc 1897 1980 1.2e-28 SMART
low complexity region 2039 2059 N/A INTRINSIC
coiled coil region 2147 2182 N/A INTRINSIC
low complexity region 2263 2329 N/A INTRINSIC
low complexity region 2355 2390 N/A INTRINSIC
low complexity region 2569 2581 N/A INTRINSIC
low complexity region 2623 2638 N/A INTRINSIC
low complexity region 2666 2693 N/A INTRINSIC
AT_hook 2726 2738 2.4e-2 SMART
low complexity region 2778 2798 N/A INTRINSIC
AT_hook 2806 2818 2.6e-3 SMART
low complexity region 2819 2830 N/A INTRINSIC
low complexity region 2839 2866 N/A INTRINSIC
AT_hook 2870 2882 2.4e-3 SMART
low complexity region 2915 2926 N/A INTRINSIC
low complexity region 2927 2937 N/A INTRINSIC
low complexity region 3024 3060 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190390
AA Change: T616I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139399
Gene: ENSMUSG00000053877
AA Change: T616I

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
HSA 125 196 5.4e-25 SMART
low complexity region 257 280 N/A INTRINSIC
low complexity region 283 310 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 396 420 N/A INTRINSIC
low complexity region 480 558 N/A INTRINSIC
low complexity region 577 592 N/A INTRINSIC
DEXDc 626 818 5e-37 SMART
low complexity region 993 1001 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
low complexity region 1150 1178 N/A INTRINSIC
low complexity region 1271 1290 N/A INTRINSIC
internal_repeat_1 1298 1341 2.01e-5 PROSPERO
low complexity region 1370 1398 N/A INTRINSIC
low complexity region 1400 1414 N/A INTRINSIC
low complexity region 1431 1449 N/A INTRINSIC
low complexity region 1451 1466 N/A INTRINSIC
low complexity region 1510 1537 N/A INTRINSIC
low complexity region 1548 1562 N/A INTRINSIC
low complexity region 1600 1629 N/A INTRINSIC
internal_repeat_1 1632 1675 2.01e-5 PROSPERO
internal_repeat_2 1633 1655 5.11e-5 PROSPERO
internal_repeat_2 1665 1685 5.11e-5 PROSPERO
low complexity region 1686 1703 N/A INTRINSIC
low complexity region 1705 1723 N/A INTRINSIC
low complexity region 1740 1774 N/A INTRINSIC
low complexity region 1809 1822 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
HELICc 2012 2095 1.2e-28 SMART
low complexity region 2154 2174 N/A INTRINSIC
coiled coil region 2262 2297 N/A INTRINSIC
low complexity region 2378 2444 N/A INTRINSIC
low complexity region 2470 2505 N/A INTRINSIC
low complexity region 2684 2696 N/A INTRINSIC
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2781 2808 N/A INTRINSIC
AT_hook 2841 2853 2.4e-2 SMART
low complexity region 2893 2913 N/A INTRINSIC
AT_hook 2921 2933 2.6e-3 SMART
low complexity region 2934 2945 N/A INTRINSIC
low complexity region 2954 2981 N/A INTRINSIC
AT_hook 2985 2997 2.4e-3 SMART
low complexity region 3030 3041 N/A INTRINSIC
low complexity region 3042 3052 N/A INTRINSIC
low complexity region 3139 3175 N/A INTRINSIC
Meta Mutation Damage Score 0.1466 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the core catalytic component of the multiprotein chromatin-remodeling SRCAP complex. The encoded protein is an ATPase that is necessary for the incorporation of the histone variant H2A.Z into nucleosomes. It can function as a transcriptional activator in Notch-mediated, CREB-mediated and steroid receptor-mediated transcription. Mutations in this gene cause Floating-Harbor syndrome, a rare disorder characterized by short stature, language deficits and dysmorphic facial features. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A T 15: 8,252,227 E2850V unknown Het
2700049A03Rik G A 12: 71,189,413 M1179I probably benign Het
6430550D23Rik T C 2: 156,003,431 T18A possibly damaging Het
Acox2 T C 14: 8,230,166 N659S probably damaging Het
Agk T C 6: 40,376,278 V192A possibly damaging Het
Ap3b1 T A 13: 94,528,158 probably null Het
Bche T A 3: 73,701,121 D324V probably damaging Het
Bsn A G 9: 108,114,740 I1271T possibly damaging Het
Capn12 T C 7: 28,882,821 L120P probably damaging Het
Cep290 T A 10: 100,563,434 S2273T probably benign Het
Ckap4 T C 10: 84,528,467 E244G probably damaging Het
Clcn7 T C 17: 25,156,822 Y545H probably damaging Het
Cmya5 T A 13: 93,098,272 T103S possibly damaging Het
Cpne9 G A 6: 113,284,445 V121M possibly damaging Het
Csmd2 T A 4: 128,483,456 I2043N Het
Disc1 A G 8: 125,087,504 T36A probably benign Het
Disp2 T C 2: 118,790,910 Y708H probably damaging Het
Dnah3 A G 7: 120,071,570 V635A probably benign Het
Dnah3 A T 7: 119,971,215 probably null Het
Dync1li1 A G 9: 114,709,277 H234R possibly damaging Het
Egfr T C 11: 16,889,966 V660A possibly damaging Het
Epb42 T C 2: 121,027,719 R253G possibly damaging Het
Fat2 T A 11: 55,311,421 T276S probably benign Het
Fcho2 A G 13: 98,764,503 probably null Het
Ginm1 A T 10: 7,779,355 I41N probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm49368 C T 7: 128,112,226 R701C probably damaging Het
Gpr37 T A 6: 25,688,208 I297F probably benign Het
Gprc5a T A 6: 135,079,344 I263N possibly damaging Het
Gys2 A T 6: 142,454,451 S345T probably benign Het
Hk2 T C 6: 82,742,915 M255V possibly damaging Het
Ibtk A C 9: 85,697,237 S1202A possibly damaging Het
Il23r T G 6: 67,423,981 D455A probably benign Het
Irs2 T A 8: 11,006,522 K637* probably null Het
Jak2 T C 19: 29,283,546 V314A probably benign Het
Mei1 C T 15: 82,082,623 probably benign Het
Mill1 T C 7: 18,262,466 M69T probably benign Het
Mms22l T C 4: 24,598,884 probably null Het
Mup8 C A 4: 60,220,332 Q133H probably benign Het
Mup8 T A 4: 60,220,333 Q133L probably benign Het
Mycbp2 A T 14: 103,191,619 Y2374N probably damaging Het
Nbeal1 A T 1: 60,257,450 K1166N probably damaging Het
Nlrc4 T A 17: 74,448,196 R8S probably benign Het
Nrcam C T 12: 44,549,898 Q25* probably null Het
Nudt16 A C 9: 105,131,561 M47R probably damaging Het
Nup62 T C 7: 44,828,995 S145P probably benign Het
Olfr1222 T C 2: 89,124,989 I247M possibly damaging Het
Olfr959 A G 9: 39,572,465 W265R probably benign Het
Osbpl1a A T 18: 12,933,600 V34D probably benign Het
Otogl T A 10: 107,876,921 N521Y probably damaging Het
Pcdhb14 T A 18: 37,449,834 D664E possibly damaging Het
Pex5l T C 3: 33,082,151 probably benign Het
Pkhd1 A G 1: 20,562,415 L592P probably damaging Het
Plxdc2 A G 2: 16,729,376 H480R probably benign Het
Rnf216 T A 5: 143,080,236 K532N probably damaging Het
Schip1 C A 3: 68,617,695 Q358K probably damaging Het
Sdc2 A T 15: 33,028,087 E117V possibly damaging Het
Sept11 A T 5: 93,171,464 probably null Het
Shprh A T 10: 11,162,180 E420V probably benign Het
Ska1 T A 18: 74,196,973 H232L probably benign Het
Slc36a4 A G 9: 15,719,660 N25S possibly damaging Het
Slitrk3 G A 3: 73,050,839 T200M probably damaging Het
Smad2 C T 18: 76,288,013 H138Y probably benign Het
Snx21 T C 2: 164,786,165 S34P probably damaging Het
Sos2 A G 12: 69,648,585 V126A probably damaging Het
Stk31 T G 6: 49,406,943 probably null Het
Stox1 T C 10: 62,663,964 D939G probably damaging Het
Syne2 G T 12: 76,061,779 C979F possibly damaging Het
Tanc2 C A 11: 105,776,858 N88K possibly damaging Het
Tll2 A T 19: 41,096,008 V677E probably damaging Het
Ttn T C 2: 76,918,490 T4072A probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Unc13b AGAGCC AGAGCCCGAGCC 4: 43,177,330 probably benign Het
Unc13b CAGAGC CAGAGCGAGAGC 4: 43,177,341 probably benign Het
Vmn2r43 A T 7: 8,255,254 F320Y possibly damaging Het
Zscan4f G T 7: 11,401,278 G204* probably null Het
Other mutations in Srcap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Srcap APN 7 127542713 splice site probably benign
IGL00475:Srcap APN 7 127552921 missense possibly damaging 0.92
IGL01064:Srcap APN 7 127559892 unclassified probably benign
IGL01129:Srcap APN 7 127521651 missense probably damaging 1.00
IGL01670:Srcap APN 7 127528432 missense probably damaging 1.00
IGL01861:Srcap APN 7 127525285 splice site probably benign
IGL02237:Srcap APN 7 127534692 splice site probably benign
IGL02665:Srcap APN 7 127540903 missense probably damaging 1.00
IGL02688:Srcap APN 7 127542453 missense probably benign 0.04
IGL02744:Srcap APN 7 127534666 missense probably damaging 1.00
IGL02810:Srcap APN 7 127521663 critical splice donor site probably null
IGL03184:Srcap APN 7 127530502 unclassified probably benign
IGL03309:Srcap APN 7 127530793 missense probably damaging 0.99
PIT4453001:Srcap UTSW 7 127549320 missense possibly damaging 0.52
R1340:Srcap UTSW 7 127560738 intron probably benign
R1401:Srcap UTSW 7 127559952 unclassified probably benign
R1455:Srcap UTSW 7 127530650 missense probably damaging 0.99
R1470:Srcap UTSW 7 127559727 unclassified probably benign
R1470:Srcap UTSW 7 127559727 unclassified probably benign
R1761:Srcap UTSW 7 127534845 missense probably damaging 1.00
R1911:Srcap UTSW 7 127534822 missense probably damaging 0.99
R2483:Srcap UTSW 7 127542147 missense probably damaging 0.99
R2892:Srcap UTSW 7 127539065 missense probably damaging 0.99
R2893:Srcap UTSW 7 127539065 missense probably damaging 0.99
R3623:Srcap UTSW 7 127542147 missense probably damaging 0.99
R3976:Srcap UTSW 7 127549239 missense probably benign 0.18
R4001:Srcap UTSW 7 127532167 missense probably damaging 1.00
R4015:Srcap UTSW 7 127525423 missense probably benign 0.27
R4581:Srcap UTSW 7 127558310 unclassified probably benign
R4643:Srcap UTSW 7 127541776 missense probably damaging 1.00
R4644:Srcap UTSW 7 127552598 missense probably damaging 1.00
R4690:Srcap UTSW 7 127538014 missense probably damaging 1.00
R4693:Srcap UTSW 7 127538544 missense probably damaging 1.00
R4719:Srcap UTSW 7 127541559 missense probably benign 0.13
R4728:Srcap UTSW 7 127540924 critical splice donor site probably null
R4740:Srcap UTSW 7 127549299 missense probably damaging 1.00
R4752:Srcap UTSW 7 127559000 unclassified probably benign
R4834:Srcap UTSW 7 127557610 critical splice donor site probably null
R4837:Srcap UTSW 7 127558962 unclassified probably benign
R4884:Srcap UTSW 7 127522017 missense probably damaging 1.00
R4889:Srcap UTSW 7 127538547 missense possibly damaging 0.94
R5088:Srcap UTSW 7 127541661 missense probably benign 0.02
R5102:Srcap UTSW 7 127530623 missense probably damaging 1.00
R5358:Srcap UTSW 7 127540320 missense probably damaging 1.00
R5372:Srcap UTSW 7 127557613 splice site probably null
R5397:Srcap UTSW 7 127553296 critical splice donor site probably null
R5481:Srcap UTSW 7 127532197 missense probably damaging 1.00
R5566:Srcap UTSW 7 127525303 missense probably damaging 0.99
R5584:Srcap UTSW 7 127528479 missense probably damaging 1.00
R5693:Srcap UTSW 7 127519816 missense probably damaging 1.00
R5769:Srcap UTSW 7 127559822 unclassified probably benign
R5805:Srcap UTSW 7 127542039 missense possibly damaging 0.87
R5806:Srcap UTSW 7 127559163 unclassified probably benign
R5921:Srcap UTSW 7 127558833 unclassified probably benign
R5942:Srcap UTSW 7 127538008 missense probably damaging 1.00
R6014:Srcap UTSW 7 127538750 missense probably benign 0.01
R6057:Srcap UTSW 7 127541356 missense probably damaging 0.99
R6113:Srcap UTSW 7 127560281 unclassified probably benign
R6150:Srcap UTSW 7 127534828 missense probably damaging 1.00
R6212:Srcap UTSW 7 127549689 missense probably damaging 1.00
R6299:Srcap UTSW 7 127530454 unclassified probably benign
R6437:Srcap UTSW 7 127528550 splice site probably null
R6492:Srcap UTSW 7 127522145 nonsense probably null
R6537:Srcap UTSW 7 127542220 missense probably damaging 0.97
R6659:Srcap UTSW 7 127542391 missense probably damaging 1.00
R6713:Srcap UTSW 7 127534917 missense probably benign 0.28
R6717:Srcap UTSW 7 127558310 unclassified probably benign
R6941:Srcap UTSW 7 127542597 missense probably damaging 1.00
R7068:Srcap UTSW 7 127541943 missense probably benign 0.00
R7097:Srcap UTSW 7 127539041 missense probably damaging 1.00
R7394:Srcap UTSW 7 127534828 missense probably damaging 1.00
R7426:Srcap UTSW 7 127538517 missense possibly damaging 0.90
R7434:Srcap UTSW 7 127560242 missense unknown
R7559:Srcap UTSW 7 127530550 missense unknown
R7638:Srcap UTSW 7 127538748 missense probably benign 0.39
R7677:Srcap UTSW 7 127559808 missense unknown
R7715:Srcap UTSW 7 127549288 missense probably damaging 0.99
R7811:Srcap UTSW 7 127542049 missense probably damaging 0.97
R7821:Srcap UTSW 7 127530327 unclassified probably benign
R7869:Srcap UTSW 7 127539194 missense possibly damaging 0.92
R7870:Srcap UTSW 7 127560558 missense unknown
R7941:Srcap UTSW 7 127558290 unclassified probably benign
R7994:Srcap UTSW 7 127541758 missense probably benign 0.00
R8035:Srcap UTSW 7 127542612 missense probably benign 0.05
R8066:Srcap UTSW 7 127521632 missense probably damaging 1.00
R8066:Srcap UTSW 7 127540312 missense possibly damaging 0.74
R8168:Srcap UTSW 7 127542523 missense probably damaging 1.00
R8194:Srcap UTSW 7 127539197 missense probably damaging 1.00
R8288:Srcap UTSW 7 127531356 missense probably damaging 1.00
R8307:Srcap UTSW 7 127525369 missense probably damaging 1.00
R8308:Srcap UTSW 7 127553181 missense possibly damaging 0.82
R8309:Srcap UTSW 7 127549357 missense probably damaging 0.98
R8311:Srcap UTSW 7 127557797 missense probably damaging 0.99
R8321:Srcap UTSW 7 127540896 missense probably damaging 1.00
R8365:Srcap UTSW 7 127549697 missense probably damaging 1.00
R8424:Srcap UTSW 7 127542388 missense probably benign 0.00
R8815:Srcap UTSW 7 127558865 missense unknown
R8817:Srcap UTSW 7 127553223 missense probably benign 0.23
R8924:Srcap UTSW 7 127559032 missense unknown
R8933:Srcap UTSW 7 127552394 missense probably damaging 1.00
R8961:Srcap UTSW 7 127541929 missense probably damaging 1.00
R9000:Srcap UTSW 7 127531771 missense possibly damaging 0.91
R9098:Srcap UTSW 7 127552644 missense probably damaging 0.99
R9124:Srcap UTSW 7 127560702 missense unknown
R9163:Srcap UTSW 7 127521990 missense unknown
R9332:Srcap UTSW 7 127559640 missense unknown
R9389:Srcap UTSW 7 127542283 missense probably damaging 1.00
R9464:Srcap UTSW 7 127538101 missense possibly damaging 0.95
R9467:Srcap UTSW 7 127540359 missense probably damaging 0.98
R9554:Srcap UTSW 7 127552405 missense probably damaging 1.00
R9596:Srcap UTSW 7 127531864 missense probably damaging 1.00
R9597:Srcap UTSW 7 127522047 missense possibly damaging 0.91
X0025:Srcap UTSW 7 127560105 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATGAGTCGGAGGATGCTCAG -3'
(R):5'- CAGTCAAGGCCAATGTGTTG -3'

Sequencing Primer
(F):5'- AGGATGCTCAGTCCCAGAG -3'
(R):5'- CAATGTGTTGGTACTCTCGGAGC -3'
Posted On 2019-11-26