Incidental Mutation 'R7757:Irs2'
ID 597617
Institutional Source Beutler Lab
Gene Symbol Irs2
Ensembl Gene ENSMUSG00000038894
Gene Name insulin receptor substrate 2
Synonyms Irs-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.553) question?
Stock # R7757 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 10984681-11008458 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 11006522 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 637 (K637*)
Ref Sequence ENSEMBL: ENSMUSP00000038514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040514]
AlphaFold P81122
PDB Structure Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide and ATP [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB phosphopeptide [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000040514
AA Change: K637*
SMART Domains Protein: ENSMUSP00000038514
Gene: ENSMUSG00000038894
AA Change: K637*

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 19 28 N/A INTRINSIC
PH 31 146 2.83e-13 SMART
IRS 191 293 4.98e-38 SMART
PTBI 191 293 2.24e-51 SMART
low complexity region 301 309 N/A INTRINSIC
low complexity region 364 377 N/A INTRINSIC
low complexity region 435 473 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 688 710 N/A INTRINSIC
low complexity region 721 730 N/A INTRINSIC
low complexity region 834 846 N/A INTRINSIC
low complexity region 923 959 N/A INTRINSIC
low complexity region 976 984 N/A INTRINSIC
low complexity region 997 1028 N/A INTRINSIC
low complexity region 1137 1154 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
low complexity region 1274 1296 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the insulin receptor substrate 2, a cytoplasmic signaling molecule that mediates effects of insulin, insulin-like growth factor 1, and other cytokines by acting as a molecular adaptor between diverse receptor tyrosine kinases and downstream effectors. The product of this gene is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation, as well as by an interleukin 4 receptor-associated kinase in response to IL4 treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene results in type 2 diabetes due to insulin resistance and pancreatic beta cell dysfunction, causes defects in leptin action, energy balance, lipid homeostasis and vascular wound healing, and leads to female infertility due to hypothalamic and ovarian dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A T 15: 8,252,227 E2850V unknown Het
2700049A03Rik G A 12: 71,189,413 M1179I probably benign Het
6430550D23Rik T C 2: 156,003,431 T18A possibly damaging Het
Acox2 T C 14: 8,230,166 N659S probably damaging Het
Agk T C 6: 40,376,278 V192A possibly damaging Het
Ap3b1 T A 13: 94,528,158 probably null Het
Bche T A 3: 73,701,121 D324V probably damaging Het
Bsn A G 9: 108,114,740 I1271T possibly damaging Het
Capn12 T C 7: 28,882,821 L120P probably damaging Het
Cep290 T A 10: 100,563,434 S2273T probably benign Het
Ckap4 T C 10: 84,528,467 E244G probably damaging Het
Clcn7 T C 17: 25,156,822 Y545H probably damaging Het
Cmya5 T A 13: 93,098,272 T103S possibly damaging Het
Cpne9 G A 6: 113,284,445 V121M possibly damaging Het
Csmd2 T A 4: 128,483,456 I2043N Het
Disc1 A G 8: 125,087,504 T36A probably benign Het
Disp2 T C 2: 118,790,910 Y708H probably damaging Het
Dnah3 A G 7: 120,071,570 V635A probably benign Het
Dnah3 A T 7: 119,971,215 probably null Het
Dync1li1 A G 9: 114,709,277 H234R possibly damaging Het
Egfr T C 11: 16,889,966 V660A possibly damaging Het
Epb42 T C 2: 121,027,719 R253G possibly damaging Het
Fat2 T A 11: 55,311,421 T276S probably benign Het
Fcho2 A G 13: 98,764,503 probably null Het
Ginm1 A T 10: 7,779,355 I41N probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm49368 C T 7: 128,112,226 R701C probably damaging Het
Gpr37 T A 6: 25,688,208 I297F probably benign Het
Gprc5a T A 6: 135,079,344 I263N possibly damaging Het
Gys2 A T 6: 142,454,451 S345T probably benign Het
Hk2 T C 6: 82,742,915 M255V possibly damaging Het
Ibtk A C 9: 85,697,237 S1202A possibly damaging Het
Il23r T G 6: 67,423,981 D455A probably benign Het
Jak2 T C 19: 29,283,546 V314A probably benign Het
Mei1 C T 15: 82,082,623 probably benign Het
Mill1 T C 7: 18,262,466 M69T probably benign Het
Mms22l T C 4: 24,598,884 probably null Het
Mup8 C A 4: 60,220,332 Q133H probably benign Het
Mup8 T A 4: 60,220,333 Q133L probably benign Het
Mycbp2 A T 14: 103,191,619 Y2374N probably damaging Het
Nbeal1 A T 1: 60,257,450 K1166N probably damaging Het
Nlrc4 T A 17: 74,448,196 R8S probably benign Het
Nrcam C T 12: 44,549,898 Q25* probably null Het
Nudt16 A C 9: 105,131,561 M47R probably damaging Het
Nup62 T C 7: 44,828,995 S145P probably benign Het
Olfr1222 T C 2: 89,124,989 I247M possibly damaging Het
Olfr959 A G 9: 39,572,465 W265R probably benign Het
Osbpl1a A T 18: 12,933,600 V34D probably benign Het
Otogl T A 10: 107,876,921 N521Y probably damaging Het
Pcdhb14 T A 18: 37,449,834 D664E possibly damaging Het
Pex5l T C 3: 33,082,151 probably benign Het
Pkhd1 A G 1: 20,562,415 L592P probably damaging Het
Plxdc2 A G 2: 16,729,376 H480R probably benign Het
Rnf216 T A 5: 143,080,236 K532N probably damaging Het
Schip1 C A 3: 68,617,695 Q358K probably damaging Het
Sdc2 A T 15: 33,028,087 E117V possibly damaging Het
Sept11 A T 5: 93,171,464 probably null Het
Shprh A T 10: 11,162,180 E420V probably benign Het
Ska1 T A 18: 74,196,973 H232L probably benign Het
Slc36a4 A G 9: 15,719,660 N25S possibly damaging Het
Slitrk3 G A 3: 73,050,839 T200M probably damaging Het
Smad2 C T 18: 76,288,013 H138Y probably benign Het
Snx21 T C 2: 164,786,165 S34P probably damaging Het
Sos2 A G 12: 69,648,585 V126A probably damaging Het
Srcap C T 7: 127,530,794 T596I probably damaging Het
Stk31 T G 6: 49,406,943 probably null Het
Stox1 T C 10: 62,663,964 D939G probably damaging Het
Syne2 G T 12: 76,061,779 C979F possibly damaging Het
Tanc2 C A 11: 105,776,858 N88K possibly damaging Het
Tll2 A T 19: 41,096,008 V677E probably damaging Het
Ttn T C 2: 76,918,490 T4072A probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Unc13b AGAGCC AGAGCCCGAGCC 4: 43,177,330 probably benign Het
Unc13b CAGAGC CAGAGCGAGAGC 4: 43,177,341 probably benign Het
Vmn2r43 A T 7: 8,255,254 F320Y possibly damaging Het
Zscan4f G T 7: 11,401,278 G204* probably null Het
Other mutations in Irs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Irs2 APN 8 11005867 missense probably benign 0.00
IGL01328:Irs2 APN 8 11004792 missense probably damaging 0.99
IGL01875:Irs2 APN 8 11006221 missense probably damaging 0.98
IGL02444:Irs2 APN 8 11006306 missense probably benign 0.03
IGL02448:Irs2 APN 8 11007862 missense probably benign 0.21
IGL02945:Irs2 APN 8 11007781 missense probably damaging 1.00
IGL03068:Irs2 APN 8 11004974 missense probably damaging 0.99
beefed UTSW 8 11006522 nonsense probably null
Dum_dum UTSW 8 10987012 makesense probably null
Lush UTSW 8 11006678 nonsense probably null
muscular UTSW 8 11004659 nonsense probably null
Plink UTSW 8 11005121 missense probably damaging 0.99
R0062:Irs2 UTSW 8 11005723 missense possibly damaging 0.65
R0062:Irs2 UTSW 8 11005723 missense possibly damaging 0.65
R0107:Irs2 UTSW 8 11004691 missense probably damaging 1.00
R0147:Irs2 UTSW 8 11007568 missense probably damaging 1.00
R0501:Irs2 UTSW 8 11006396 missense probably damaging 1.00
R0565:Irs2 UTSW 8 11004592 missense probably damaging 0.98
R2042:Irs2 UTSW 8 11007580 missense probably damaging 0.99
R2268:Irs2 UTSW 8 11007586 missense probably damaging 0.98
R2518:Irs2 UTSW 8 11005352 missense probably benign 0.00
R2762:Irs2 UTSW 8 11006408 missense probably damaging 1.00
R3623:Irs2 UTSW 8 11007643 missense probably damaging 1.00
R3624:Irs2 UTSW 8 11007643 missense probably damaging 1.00
R5022:Irs2 UTSW 8 10987012 makesense probably null
R5270:Irs2 UTSW 8 11006678 nonsense probably null
R5377:Irs2 UTSW 8 11005277 missense probably benign 0.00
R5604:Irs2 UTSW 8 11005007 missense possibly damaging 0.84
R6049:Irs2 UTSW 8 11006805 missense probably benign 0.01
R6219:Irs2 UTSW 8 11005121 missense probably damaging 0.99
R6654:Irs2 UTSW 8 11006486 missense probably damaging 1.00
R6726:Irs2 UTSW 8 11004961 missense possibly damaging 0.86
R6813:Irs2 UTSW 8 11004659 nonsense probably null
R6934:Irs2 UTSW 8 11004697 missense probably damaging 0.99
R7261:Irs2 UTSW 8 11007018 missense possibly damaging 0.95
R7285:Irs2 UTSW 8 11006797 missense probably damaging 0.99
R7458:Irs2 UTSW 8 11007739 missense probably damaging 0.99
R8347:Irs2 UTSW 8 11008000 missense possibly damaging 0.82
R8348:Irs2 UTSW 8 11004974 missense probably damaging 0.98
R8377:Irs2 UTSW 8 11004848 nonsense probably null
R8444:Irs2 UTSW 8 11006683 missense probably damaging 0.99
R8912:Irs2 UTSW 8 11006655 missense probably damaging 0.96
R9229:Irs2 UTSW 8 11007400 missense probably damaging 1.00
R9344:Irs2 UTSW 8 11007289 nonsense probably null
R9405:Irs2 UTSW 8 11005061 missense possibly damaging 0.95
R9484:Irs2 UTSW 8 11007334 missense probably damaging 0.99
R9736:Irs2 UTSW 8 11008217 missense probably damaging 1.00
Z1176:Irs2 UTSW 8 11006185 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTTACTGGGAAGGTCCTGCC -3'
(R):5'- GGACTTATTCCCTAACCACGC -3'

Sequencing Primer
(F):5'- TCCTGCCCACCCCTGAAG -3'
(R):5'- TAACCACGCCTGCCAGG -3'
Posted On 2019-11-26