Incidental Mutation 'R7757:Irs2'
ID 597617
Institutional Source Beutler Lab
Gene Symbol Irs2
Ensembl Gene ENSMUSG00000038894
Gene Name insulin receptor substrate 2
Synonyms Irs-2
MMRRC Submission 045813-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.579) question?
Stock # R7757 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 11034681-11058458 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 11056522 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 637 (K637*)
Ref Sequence ENSEMBL: ENSMUSP00000038514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040514]
AlphaFold P81122
PDB Structure Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide and ATP [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB phosphopeptide [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000040514
AA Change: K637*
SMART Domains Protein: ENSMUSP00000038514
Gene: ENSMUSG00000038894
AA Change: K637*

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 19 28 N/A INTRINSIC
PH 31 146 2.83e-13 SMART
IRS 191 293 4.98e-38 SMART
PTBI 191 293 2.24e-51 SMART
low complexity region 301 309 N/A INTRINSIC
low complexity region 364 377 N/A INTRINSIC
low complexity region 435 473 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 688 710 N/A INTRINSIC
low complexity region 721 730 N/A INTRINSIC
low complexity region 834 846 N/A INTRINSIC
low complexity region 923 959 N/A INTRINSIC
low complexity region 976 984 N/A INTRINSIC
low complexity region 997 1028 N/A INTRINSIC
low complexity region 1137 1154 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
low complexity region 1274 1296 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the insulin receptor substrate 2, a cytoplasmic signaling molecule that mediates effects of insulin, insulin-like growth factor 1, and other cytokines by acting as a molecular adaptor between diverse receptor tyrosine kinases and downstream effectors. The product of this gene is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation, as well as by an interleukin 4 receptor-associated kinase in response to IL4 treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene results in type 2 diabetes due to insulin resistance and pancreatic beta cell dysfunction, causes defects in leptin action, energy balance, lipid homeostasis and vascular wound healing, and leads to female infertility due to hypothalamic and ovarian dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,236,187 (GRCm39) M1179I probably benign Het
6430550D23Rik T C 2: 155,845,351 (GRCm39) T18A possibly damaging Het
Acox2 T C 14: 8,230,166 (GRCm38) N659S probably damaging Het
Agk T C 6: 40,353,212 (GRCm39) V192A possibly damaging Het
Ap3b1 T A 13: 94,664,666 (GRCm39) probably null Het
Bche T A 3: 73,608,454 (GRCm39) D324V probably damaging Het
Bsn A G 9: 107,991,939 (GRCm39) I1271T possibly damaging Het
Capn12 T C 7: 28,582,246 (GRCm39) L120P probably damaging Het
Cep290 T A 10: 100,399,296 (GRCm39) S2273T probably benign Het
Ckap4 T C 10: 84,364,331 (GRCm39) E244G probably damaging Het
Clcn7 T C 17: 25,375,796 (GRCm39) Y545H probably damaging Het
Cmya5 T A 13: 93,234,780 (GRCm39) T103S possibly damaging Het
Cplane1 A T 15: 8,281,711 (GRCm39) E2850V unknown Het
Cpne9 G A 6: 113,261,406 (GRCm39) V121M possibly damaging Het
Csmd2 T A 4: 128,377,249 (GRCm39) I2043N Het
Disc1 A G 8: 125,814,243 (GRCm39) T36A probably benign Het
Disp2 T C 2: 118,621,391 (GRCm39) Y708H probably damaging Het
Dnah3 A G 7: 119,670,793 (GRCm39) V635A probably benign Het
Dnah3 A T 7: 119,570,438 (GRCm39) probably null Het
Dync1li1 A G 9: 114,538,345 (GRCm39) H234R possibly damaging Het
Egfr T C 11: 16,839,966 (GRCm39) V660A possibly damaging Het
Epb42 T C 2: 120,858,200 (GRCm39) R253G possibly damaging Het
Fat2 T A 11: 55,202,247 (GRCm39) T276S probably benign Het
Fcho2 A G 13: 98,901,011 (GRCm39) probably null Het
Ginm1 A T 10: 7,655,119 (GRCm39) I41N probably damaging Het
Gm4744 A G 6: 40,927,367 (GRCm39) probably benign Het
Gm49368 C T 7: 127,711,398 (GRCm39) R701C probably damaging Het
Gpr37 T A 6: 25,688,207 (GRCm39) I297F probably benign Het
Gprc5a T A 6: 135,056,342 (GRCm39) I263N possibly damaging Het
Gys2 A T 6: 142,400,177 (GRCm39) S345T probably benign Het
Hk2 T C 6: 82,719,896 (GRCm39) M255V possibly damaging Het
Ibtk A C 9: 85,579,290 (GRCm39) S1202A possibly damaging Het
Il23r T G 6: 67,400,965 (GRCm39) D455A probably benign Het
Jak2 T C 19: 29,260,946 (GRCm39) V314A probably benign Het
Mei1 C T 15: 81,966,824 (GRCm39) probably benign Het
Mill1 T C 7: 17,996,391 (GRCm39) M69T probably benign Het
Mms22l T C 4: 24,598,884 (GRCm39) probably null Het
Mup8 C A 4: 60,220,332 (GRCm39) Q133H probably benign Het
Mup8 T A 4: 60,220,333 (GRCm39) Q133L probably benign Het
Mycbp2 A T 14: 103,429,055 (GRCm39) Y2374N probably damaging Het
Nbeal1 A T 1: 60,296,609 (GRCm39) K1166N probably damaging Het
Nlrc4 T A 17: 74,755,191 (GRCm39) R8S probably benign Het
Nrcam C T 12: 44,596,681 (GRCm39) Q25* probably null Het
Nudt16 A C 9: 105,008,760 (GRCm39) M47R probably damaging Het
Nup62 T C 7: 44,478,419 (GRCm39) S145P probably benign Het
Or10d1 A G 9: 39,483,761 (GRCm39) W265R probably benign Het
Or4c117 T C 2: 88,955,333 (GRCm39) I247M possibly damaging Het
Osbpl1a A T 18: 13,066,657 (GRCm39) V34D probably benign Het
Otogl T A 10: 107,712,782 (GRCm39) N521Y probably damaging Het
Pcdhb14 T A 18: 37,582,887 (GRCm39) D664E possibly damaging Het
Pex5l T C 3: 33,136,300 (GRCm39) probably benign Het
Pkhd1 A G 1: 20,632,639 (GRCm39) L592P probably damaging Het
Plxdc2 A G 2: 16,734,187 (GRCm39) H480R probably benign Het
Rnf216 T A 5: 143,065,991 (GRCm39) K532N probably damaging Het
Schip1 C A 3: 68,525,028 (GRCm39) Q358K probably damaging Het
Sdc2 A T 15: 33,028,233 (GRCm39) E117V possibly damaging Het
Septin11 A T 5: 93,319,323 (GRCm39) probably null Het
Shprh A T 10: 11,037,924 (GRCm39) E420V probably benign Het
Ska1 T A 18: 74,330,044 (GRCm39) H232L probably benign Het
Slc36a4 A G 9: 15,630,956 (GRCm39) N25S possibly damaging Het
Slitrk3 G A 3: 72,958,172 (GRCm39) T200M probably damaging Het
Smad2 C T 18: 76,421,084 (GRCm39) H138Y probably benign Het
Snx21 T C 2: 164,628,085 (GRCm39) S34P probably damaging Het
Sos2 A G 12: 69,695,359 (GRCm39) V126A probably damaging Het
Srcap C T 7: 127,129,966 (GRCm39) T596I probably damaging Het
Stk31 T G 6: 49,383,877 (GRCm39) probably null Het
Stox1 T C 10: 62,499,743 (GRCm39) D939G probably damaging Het
Syne2 G T 12: 76,108,553 (GRCm39) C979F possibly damaging Het
Tanc2 C A 11: 105,667,684 (GRCm39) N88K possibly damaging Het
Tll2 A T 19: 41,084,447 (GRCm39) V677E probably damaging Het
Ttn T C 2: 76,748,834 (GRCm39) T4072A probably benign Het
Unc13b CAGAGC CAGAGCGAGAGC 4: 43,177,341 (GRCm39) probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 (GRCm39) probably benign Het
Unc13b AGAGCC AGAGCCCGAGCC 4: 43,177,330 (GRCm39) probably benign Het
Vmn2r43 A T 7: 8,258,253 (GRCm39) F320Y possibly damaging Het
Zscan4f G T 7: 11,135,205 (GRCm39) G204* probably null Het
Other mutations in Irs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Irs2 APN 8 11,055,867 (GRCm39) missense probably benign 0.00
IGL01328:Irs2 APN 8 11,054,792 (GRCm39) missense probably damaging 0.99
IGL01875:Irs2 APN 8 11,056,221 (GRCm39) missense probably damaging 0.98
IGL02444:Irs2 APN 8 11,056,306 (GRCm39) missense probably benign 0.03
IGL02448:Irs2 APN 8 11,057,862 (GRCm39) missense probably benign 0.21
IGL02945:Irs2 APN 8 11,057,781 (GRCm39) missense probably damaging 1.00
IGL03068:Irs2 APN 8 11,054,974 (GRCm39) missense probably damaging 0.99
beefed UTSW 8 11,056,522 (GRCm39) nonsense probably null
Dum_dum UTSW 8 11,037,012 (GRCm39) makesense probably null
Lush UTSW 8 11,056,678 (GRCm39) nonsense probably null
muscular UTSW 8 11,054,659 (GRCm39) nonsense probably null
Plink UTSW 8 11,055,121 (GRCm39) missense probably damaging 0.99
R0062:Irs2 UTSW 8 11,055,723 (GRCm39) missense possibly damaging 0.65
R0062:Irs2 UTSW 8 11,055,723 (GRCm39) missense possibly damaging 0.65
R0107:Irs2 UTSW 8 11,054,691 (GRCm39) missense probably damaging 1.00
R0147:Irs2 UTSW 8 11,057,568 (GRCm39) missense probably damaging 1.00
R0501:Irs2 UTSW 8 11,056,396 (GRCm39) missense probably damaging 1.00
R0565:Irs2 UTSW 8 11,054,592 (GRCm39) missense probably damaging 0.98
R2042:Irs2 UTSW 8 11,057,580 (GRCm39) missense probably damaging 0.99
R2268:Irs2 UTSW 8 11,057,586 (GRCm39) missense probably damaging 0.98
R2518:Irs2 UTSW 8 11,055,352 (GRCm39) missense probably benign 0.00
R2762:Irs2 UTSW 8 11,056,408 (GRCm39) missense probably damaging 1.00
R3623:Irs2 UTSW 8 11,057,643 (GRCm39) missense probably damaging 1.00
R3624:Irs2 UTSW 8 11,057,643 (GRCm39) missense probably damaging 1.00
R5022:Irs2 UTSW 8 11,037,012 (GRCm39) makesense probably null
R5270:Irs2 UTSW 8 11,056,678 (GRCm39) nonsense probably null
R5377:Irs2 UTSW 8 11,055,277 (GRCm39) missense probably benign 0.00
R5604:Irs2 UTSW 8 11,055,007 (GRCm39) missense possibly damaging 0.84
R6049:Irs2 UTSW 8 11,056,805 (GRCm39) missense probably benign 0.01
R6219:Irs2 UTSW 8 11,055,121 (GRCm39) missense probably damaging 0.99
R6654:Irs2 UTSW 8 11,056,486 (GRCm39) missense probably damaging 1.00
R6726:Irs2 UTSW 8 11,054,961 (GRCm39) missense possibly damaging 0.86
R6813:Irs2 UTSW 8 11,054,659 (GRCm39) nonsense probably null
R6934:Irs2 UTSW 8 11,054,697 (GRCm39) missense probably damaging 0.99
R7261:Irs2 UTSW 8 11,057,018 (GRCm39) missense possibly damaging 0.95
R7285:Irs2 UTSW 8 11,056,797 (GRCm39) missense probably damaging 0.99
R7458:Irs2 UTSW 8 11,057,739 (GRCm39) missense probably damaging 0.99
R8347:Irs2 UTSW 8 11,058,000 (GRCm39) missense possibly damaging 0.82
R8348:Irs2 UTSW 8 11,054,974 (GRCm39) missense probably damaging 0.98
R8377:Irs2 UTSW 8 11,054,848 (GRCm39) nonsense probably null
R8444:Irs2 UTSW 8 11,056,683 (GRCm39) missense probably damaging 0.99
R8912:Irs2 UTSW 8 11,056,655 (GRCm39) missense probably damaging 0.96
R9229:Irs2 UTSW 8 11,057,400 (GRCm39) missense probably damaging 1.00
R9344:Irs2 UTSW 8 11,057,289 (GRCm39) nonsense probably null
R9405:Irs2 UTSW 8 11,055,061 (GRCm39) missense possibly damaging 0.95
R9484:Irs2 UTSW 8 11,057,334 (GRCm39) missense probably damaging 0.99
R9736:Irs2 UTSW 8 11,058,217 (GRCm39) missense probably damaging 1.00
Z1176:Irs2 UTSW 8 11,056,185 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTTACTGGGAAGGTCCTGCC -3'
(R):5'- GGACTTATTCCCTAACCACGC -3'

Sequencing Primer
(F):5'- TCCTGCCCACCCCTGAAG -3'
(R):5'- TAACCACGCCTGCCAGG -3'
Posted On 2019-11-26