Incidental Mutation 'R7757:Disc1'
ID 597618
Institutional Source Beutler Lab
Gene Symbol Disc1
Ensembl Gene ENSMUSG00000043051
Gene Name disrupted in schizophrenia 1
Synonyms
MMRRC Submission 045813-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.328) question?
Stock # R7757 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 125780934-125988597 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 125814243 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 36 (T36A)
Ref Sequence ENSEMBL: ENSMUSP00000095914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074562] [ENSMUST00000075730] [ENSMUST00000098311] [ENSMUST00000115885] [ENSMUST00000117658] [ENSMUST00000118942] [ENSMUST00000121953] [ENSMUST00000122389]
AlphaFold Q811T9
Predicted Effect probably benign
Transcript: ENSMUST00000074562
AA Change: T36A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000074147
Gene: ENSMUSG00000043051
AA Change: T36A

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075730
AA Change: T36A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000075145
Gene: ENSMUSG00000043051
AA Change: T36A

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098311
AA Change: T36A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000095914
Gene: ENSMUSG00000043051
AA Change: T36A

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115885
AA Change: T36A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000111552
Gene: ENSMUSG00000043051
AA Change: T36A

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117658
AA Change: T36A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000112757
Gene: ENSMUSG00000043051
AA Change: T36A

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118942
AA Change: T36A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112410
Gene: ENSMUSG00000043051
AA Change: T36A

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
coiled coil region 372 397 N/A INTRINSIC
coiled coil region 449 496 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121953
AA Change: T34A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112929
Gene: ENSMUSG00000043051
AA Change: T34A

DomainStartEndE-ValueType
low complexity region 218 228 N/A INTRINSIC
low complexity region 286 322 N/A INTRINSIC
coiled coil region 370 395 N/A INTRINSIC
coiled coil region 447 494 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
low complexity region 622 634 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122389
AA Change: T36A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112593
Gene: ENSMUSG00000043051
AA Change: T36A

DomainStartEndE-ValueType
low complexity region 220 230 N/A INTRINSIC
low complexity region 288 324 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple coiled coil motifs which is located in the nucleus, cytoplasm and mitochondria. The protein is involved in neurite outgrowth and cortical development through its interaction with other proteins. This gene is disrupted in a t(1;11)(q42.1;q14.3) translocation which segregates with schizophrenia and related psychiatric disorders in a large Scottish family. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show altered anxiety, synaptic depression, LTP, impulsivity, social investigation, hyperactivity and prepulse inhibition. Homozygotes for a spontaneous allele show altered working memory. Different ENU mutations cause distinct depression and schizophrenia-like profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,236,187 (GRCm39) M1179I probably benign Het
6430550D23Rik T C 2: 155,845,351 (GRCm39) T18A possibly damaging Het
Acox2 T C 14: 8,230,166 (GRCm38) N659S probably damaging Het
Agk T C 6: 40,353,212 (GRCm39) V192A possibly damaging Het
Ap3b1 T A 13: 94,664,666 (GRCm39) probably null Het
Bche T A 3: 73,608,454 (GRCm39) D324V probably damaging Het
Bsn A G 9: 107,991,939 (GRCm39) I1271T possibly damaging Het
Capn12 T C 7: 28,582,246 (GRCm39) L120P probably damaging Het
Cep290 T A 10: 100,399,296 (GRCm39) S2273T probably benign Het
Ckap4 T C 10: 84,364,331 (GRCm39) E244G probably damaging Het
Clcn7 T C 17: 25,375,796 (GRCm39) Y545H probably damaging Het
Cmya5 T A 13: 93,234,780 (GRCm39) T103S possibly damaging Het
Cplane1 A T 15: 8,281,711 (GRCm39) E2850V unknown Het
Cpne9 G A 6: 113,261,406 (GRCm39) V121M possibly damaging Het
Csmd2 T A 4: 128,377,249 (GRCm39) I2043N Het
Disp2 T C 2: 118,621,391 (GRCm39) Y708H probably damaging Het
Dnah3 A G 7: 119,670,793 (GRCm39) V635A probably benign Het
Dnah3 A T 7: 119,570,438 (GRCm39) probably null Het
Dync1li1 A G 9: 114,538,345 (GRCm39) H234R possibly damaging Het
Egfr T C 11: 16,839,966 (GRCm39) V660A possibly damaging Het
Epb42 T C 2: 120,858,200 (GRCm39) R253G possibly damaging Het
Fat2 T A 11: 55,202,247 (GRCm39) T276S probably benign Het
Fcho2 A G 13: 98,901,011 (GRCm39) probably null Het
Ginm1 A T 10: 7,655,119 (GRCm39) I41N probably damaging Het
Gm4744 A G 6: 40,927,367 (GRCm39) probably benign Het
Gm49368 C T 7: 127,711,398 (GRCm39) R701C probably damaging Het
Gpr37 T A 6: 25,688,207 (GRCm39) I297F probably benign Het
Gprc5a T A 6: 135,056,342 (GRCm39) I263N possibly damaging Het
Gys2 A T 6: 142,400,177 (GRCm39) S345T probably benign Het
Hk2 T C 6: 82,719,896 (GRCm39) M255V possibly damaging Het
Ibtk A C 9: 85,579,290 (GRCm39) S1202A possibly damaging Het
Il23r T G 6: 67,400,965 (GRCm39) D455A probably benign Het
Irs2 T A 8: 11,056,522 (GRCm39) K637* probably null Het
Jak2 T C 19: 29,260,946 (GRCm39) V314A probably benign Het
Mei1 C T 15: 81,966,824 (GRCm39) probably benign Het
Mill1 T C 7: 17,996,391 (GRCm39) M69T probably benign Het
Mms22l T C 4: 24,598,884 (GRCm39) probably null Het
Mup8 C A 4: 60,220,332 (GRCm39) Q133H probably benign Het
Mup8 T A 4: 60,220,333 (GRCm39) Q133L probably benign Het
Mycbp2 A T 14: 103,429,055 (GRCm39) Y2374N probably damaging Het
Nbeal1 A T 1: 60,296,609 (GRCm39) K1166N probably damaging Het
Nlrc4 T A 17: 74,755,191 (GRCm39) R8S probably benign Het
Nrcam C T 12: 44,596,681 (GRCm39) Q25* probably null Het
Nudt16 A C 9: 105,008,760 (GRCm39) M47R probably damaging Het
Nup62 T C 7: 44,478,419 (GRCm39) S145P probably benign Het
Or10d1 A G 9: 39,483,761 (GRCm39) W265R probably benign Het
Or4c117 T C 2: 88,955,333 (GRCm39) I247M possibly damaging Het
Osbpl1a A T 18: 13,066,657 (GRCm39) V34D probably benign Het
Otogl T A 10: 107,712,782 (GRCm39) N521Y probably damaging Het
Pcdhb14 T A 18: 37,582,887 (GRCm39) D664E possibly damaging Het
Pex5l T C 3: 33,136,300 (GRCm39) probably benign Het
Pkhd1 A G 1: 20,632,639 (GRCm39) L592P probably damaging Het
Plxdc2 A G 2: 16,734,187 (GRCm39) H480R probably benign Het
Rnf216 T A 5: 143,065,991 (GRCm39) K532N probably damaging Het
Schip1 C A 3: 68,525,028 (GRCm39) Q358K probably damaging Het
Sdc2 A T 15: 33,028,233 (GRCm39) E117V possibly damaging Het
Septin11 A T 5: 93,319,323 (GRCm39) probably null Het
Shprh A T 10: 11,037,924 (GRCm39) E420V probably benign Het
Ska1 T A 18: 74,330,044 (GRCm39) H232L probably benign Het
Slc36a4 A G 9: 15,630,956 (GRCm39) N25S possibly damaging Het
Slitrk3 G A 3: 72,958,172 (GRCm39) T200M probably damaging Het
Smad2 C T 18: 76,421,084 (GRCm39) H138Y probably benign Het
Snx21 T C 2: 164,628,085 (GRCm39) S34P probably damaging Het
Sos2 A G 12: 69,695,359 (GRCm39) V126A probably damaging Het
Srcap C T 7: 127,129,966 (GRCm39) T596I probably damaging Het
Stk31 T G 6: 49,383,877 (GRCm39) probably null Het
Stox1 T C 10: 62,499,743 (GRCm39) D939G probably damaging Het
Syne2 G T 12: 76,108,553 (GRCm39) C979F possibly damaging Het
Tanc2 C A 11: 105,667,684 (GRCm39) N88K possibly damaging Het
Tll2 A T 19: 41,084,447 (GRCm39) V677E probably damaging Het
Ttn T C 2: 76,748,834 (GRCm39) T4072A probably benign Het
Unc13b CAGAGC CAGAGCGAGAGC 4: 43,177,341 (GRCm39) probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 (GRCm39) probably benign Het
Unc13b AGAGCC AGAGCCCGAGCC 4: 43,177,330 (GRCm39) probably benign Het
Vmn2r43 A T 7: 8,258,253 (GRCm39) F320Y possibly damaging Het
Zscan4f G T 7: 11,135,205 (GRCm39) G204* probably null Het
Other mutations in Disc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Disc1 APN 8 125,815,014 (GRCm39) missense probably benign 0.27
IGL01319:Disc1 APN 8 125,814,630 (GRCm39) missense probably damaging 0.99
IGL02001:Disc1 APN 8 125,977,781 (GRCm39) missense probably damaging 0.97
IGL02403:Disc1 APN 8 125,862,258 (GRCm39) splice site probably benign
IGL02445:Disc1 APN 8 125,875,142 (GRCm39) splice site probably benign
R0334:Disc1 UTSW 8 125,987,836 (GRCm39) splice site probably null
R0992:Disc1 UTSW 8 125,814,781 (GRCm39) missense probably damaging 1.00
R1654:Disc1 UTSW 8 125,875,204 (GRCm39) missense possibly damaging 0.90
R1711:Disc1 UTSW 8 125,851,349 (GRCm39) missense probably benign 0.05
R3154:Disc1 UTSW 8 125,862,043 (GRCm39) missense probably damaging 1.00
R3947:Disc1 UTSW 8 125,814,874 (GRCm39) missense probably damaging 1.00
R3948:Disc1 UTSW 8 125,814,874 (GRCm39) missense probably damaging 1.00
R3949:Disc1 UTSW 8 125,814,874 (GRCm39) missense probably damaging 1.00
R4051:Disc1 UTSW 8 125,875,164 (GRCm39) missense possibly damaging 0.85
R4199:Disc1 UTSW 8 125,875,198 (GRCm39) missense probably damaging 1.00
R4691:Disc1 UTSW 8 125,875,186 (GRCm39) missense possibly damaging 0.90
R4763:Disc1 UTSW 8 125,851,277 (GRCm39) missense probably damaging 1.00
R4825:Disc1 UTSW 8 125,862,041 (GRCm39) missense possibly damaging 0.86
R4969:Disc1 UTSW 8 125,851,289 (GRCm39) nonsense probably null
R5087:Disc1 UTSW 8 125,858,899 (GRCm39) missense probably benign
R5383:Disc1 UTSW 8 125,862,196 (GRCm39) missense probably damaging 1.00
R5827:Disc1 UTSW 8 125,862,104 (GRCm39) missense probably damaging 1.00
R5828:Disc1 UTSW 8 125,977,763 (GRCm39) missense probably damaging 0.99
R6431:Disc1 UTSW 8 125,862,128 (GRCm39) missense possibly damaging 0.87
R6501:Disc1 UTSW 8 125,944,844 (GRCm39) missense probably benign 0.00
R6794:Disc1 UTSW 8 125,814,514 (GRCm39) missense probably benign 0.37
R7058:Disc1 UTSW 8 125,977,724 (GRCm39) missense probably damaging 1.00
R7350:Disc1 UTSW 8 125,891,841 (GRCm39) missense probably damaging 1.00
R7365:Disc1 UTSW 8 125,881,780 (GRCm39) missense probably damaging 1.00
R7732:Disc1 UTSW 8 125,977,714 (GRCm39) nonsense probably null
R8113:Disc1 UTSW 8 125,815,014 (GRCm39) missense probably benign 0.27
R8179:Disc1 UTSW 8 125,814,316 (GRCm39) missense probably benign 0.05
R8400:Disc1 UTSW 8 125,959,732 (GRCm39) missense probably benign 0.02
R8459:Disc1 UTSW 8 125,891,894 (GRCm39) missense possibly damaging 0.91
R8492:Disc1 UTSW 8 125,817,177 (GRCm39) missense probably damaging 1.00
R8762:Disc1 UTSW 8 125,881,796 (GRCm39) missense probably damaging 1.00
R8857:Disc1 UTSW 8 125,891,870 (GRCm39) missense probably damaging 1.00
R8858:Disc1 UTSW 8 125,977,781 (GRCm39) missense probably damaging 0.97
R8936:Disc1 UTSW 8 125,814,754 (GRCm39) missense probably damaging 0.97
R9365:Disc1 UTSW 8 125,851,285 (GRCm39) missense probably benign 0.00
R9599:Disc1 UTSW 8 125,814,261 (GRCm39) missense possibly damaging 0.91
R9728:Disc1 UTSW 8 125,959,795 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AGACATACAGTAGGGCCTGC -3'
(R):5'- TTGAGAAAAGGCTTGCCCAC -3'

Sequencing Primer
(F):5'- ACTCCCTCTGGTAGTAAGGATGAC -3'
(R):5'- GAAAAGGCTTGCCCACCAGTG -3'
Posted On 2019-11-26