Mutagenetix > Incidental Mutation

Incidental Mutation 'R7757:Dync1li1'

597624

Institutional Source

Beutler Lab

Gene Symbol

Dync1li1

Ensembl Gene

ENSMUSG00000032435

Gene Name

dynein cytoplasmic 1 light intermediate chain 1

Synonyms

Dnclic1, 1110053F02Rik, LIC-1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.782) question?

Stock #

R7757 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114688790-114724302 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 114709277 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 234 (H234R)

Ref Sequence

ENSEMBL: ENSMUSP00000035366 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047404]

AlphaFold

Q8R1Q8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047404
AA Change: H234R

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000035366
Gene: ENSMUSG00000032435
AA Change: H234R

Domain	Start	End	E-Value	Type
Pfam:DLIC	43	519	2.7e-258	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

96% (70/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to light intermediate subunit family, whose members are components of the multiprotein cytoplasmic dynein complex, which is involved in intracellular trafficking and chromosome segregation during mitosis. The protein plays a role in moving the spindle assembly checkpoint (SAC) from kinetochores to spindle poles. The protein may also mediate binding to other cargo molecules to facilitate intracellular vesicle trafficking. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit increased anxiety-related response, increased dendrite length, increased neuron migration, and decreased lysosome trafficking. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	A	T	15: 8,252,227	E2850V	unknown	Het
2700049A03Rik	G	A	12: 71,189,413	M1179I	probably benign	Het
6430550D23Rik	T	C	2: 156,003,431	T18A	possibly damaging	Het
Acox2	T	C	14: 8,230,166	N659S	probably damaging	Het
Agk	T	C	6: 40,376,278	V192A	possibly damaging	Het
Ap3b1	T	A	13: 94,528,158		probably null	Het
Bche	T	A	3: 73,701,121	D324V	probably damaging	Het
Bsn	A	G	9: 108,114,740	I1271T	possibly damaging	Het
Capn12	T	C	7: 28,882,821	L120P	probably damaging	Het
Cep290	T	A	10: 100,563,434	S2273T	probably benign	Het
Ckap4	T	C	10: 84,528,467	E244G	probably damaging	Het
Clcn7	T	C	17: 25,156,822	Y545H	probably damaging	Het
Cmya5	T	A	13: 93,098,272	T103S	possibly damaging	Het
Cpne9	G	A	6: 113,284,445	V121M	possibly damaging	Het
Csmd2	T	A	4: 128,483,456	I2043N		Het
Disc1	A	G	8: 125,087,504	T36A	probably benign	Het
Disp2	T	C	2: 118,790,910	Y708H	probably damaging	Het
Dnah3	A	G	7: 120,071,570	V635A	probably benign	Het
Dnah3	A	T	7: 119,971,215		probably null	Het
Egfr	T	C	11: 16,889,966	V660A	possibly damaging	Het
Epb42	T	C	2: 121,027,719	R253G	possibly damaging	Het
Fat2	T	A	11: 55,311,421	T276S	probably benign	Het
Fcho2	A	G	13: 98,764,503		probably null	Het
Ginm1	A	T	10: 7,779,355	I41N	probably damaging	Het
Gm4744	A	G	6: 40,950,433		probably benign	Het
Gm49368	C	T	7: 128,112,226	R701C	probably damaging	Het
Gpr37	T	A	6: 25,688,208	I297F	probably benign	Het
Gprc5a	T	A	6: 135,079,344	I263N	possibly damaging	Het
Gys2	A	T	6: 142,454,451	S345T	probably benign	Het
Hk2	T	C	6: 82,742,915	M255V	possibly damaging	Het
Ibtk	A	C	9: 85,697,237	S1202A	possibly damaging	Het
Il23r	T	G	6: 67,423,981	D455A	probably benign	Het
Irs2	T	A	8: 11,006,522	K637*	probably null	Het
Jak2	T	C	19: 29,283,546	V314A	probably benign	Het
Mei1	C	T	15: 82,082,623		probably benign	Het
Mill1	T	C	7: 18,262,466	M69T	probably benign	Het
Mms22l	T	C	4: 24,598,884		probably null	Het
Mup8	C	A	4: 60,220,332	Q133H	probably benign	Het
Mup8	T	A	4: 60,220,333	Q133L	probably benign	Het
Mycbp2	A	T	14: 103,191,619	Y2374N	probably damaging	Het
Nbeal1	A	T	1: 60,257,450	K1166N	probably damaging	Het
Nlrc4	T	A	17: 74,448,196	R8S	probably benign	Het
Nrcam	C	T	12: 44,549,898	Q25*	probably null	Het
Nudt16	A	C	9: 105,131,561	M47R	probably damaging	Het
Nup62	T	C	7: 44,828,995	S145P	probably benign	Het
Olfr1222	T	C	2: 89,124,989	I247M	possibly damaging	Het
Olfr959	A	G	9: 39,572,465	W265R	probably benign	Het
Osbpl1a	A	T	18: 12,933,600	V34D	probably benign	Het
Otogl	T	A	10: 107,876,921	N521Y	probably damaging	Het
Pcdhb14	T	A	18: 37,449,834	D664E	possibly damaging	Het
Pex5l	T	C	3: 33,082,151		probably benign	Het
Pkhd1	A	G	1: 20,562,415	L592P	probably damaging	Het
Plxdc2	A	G	2: 16,729,376	H480R	probably benign	Het
Rnf216	T	A	5: 143,080,236	K532N	probably damaging	Het
Schip1	C	A	3: 68,617,695	Q358K	probably damaging	Het
Sdc2	A	T	15: 33,028,087	E117V	possibly damaging	Het
Sept11	A	T	5: 93,171,464		probably null	Het
Shprh	A	T	10: 11,162,180	E420V	probably benign	Het
Ska1	T	A	18: 74,196,973	H232L	probably benign	Het
Slc36a4	A	G	9: 15,719,660	N25S	possibly damaging	Het
Slitrk3	G	A	3: 73,050,839	T200M	probably damaging	Het
Smad2	C	T	18: 76,288,013	H138Y	probably benign	Het
Snx21	T	C	2: 164,786,165	S34P	probably damaging	Het
Sos2	A	G	12: 69,648,585	V126A	probably damaging	Het
Srcap	C	T	7: 127,530,794	T596I	probably damaging	Het
Stk31	T	G	6: 49,406,943		probably null	Het
Stox1	T	C	10: 62,663,964	D939G	probably damaging	Het
Syne2	G	T	12: 76,061,779	C979F	possibly damaging	Het
Tanc2	C	A	11: 105,776,858	N88K	possibly damaging	Het
Tll2	A	T	19: 41,096,008	V677E	probably damaging	Het
Ttn	T	C	2: 76,918,490	T4072A	probably benign	Het
Unc13b	CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC	CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC	4: 43,177,312		probably benign	Het
Unc13b	AGAGCC	AGAGCCCGAGCC	4: 43,177,330		probably benign	Het
Unc13b	CAGAGC	CAGAGCGAGAGC	4: 43,177,341		probably benign	Het
Vmn2r43	A	T	7: 8,255,254	F320Y	possibly damaging	Het
Zscan4f	G	T	7: 11,401,278	G204*	probably null	Het

Other mutations in Dync1li1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01081:Dync1li1	APN	9	114720597	missense	possibly damaging	0.89
R1510:Dync1li1	UTSW	9	114689210	missense	possibly damaging	0.59
R1824:Dync1li1	UTSW	9	114709184	missense	probably benign	0.01
R1955:Dync1li1	UTSW	9	114721746	missense	probably damaging	0.99
R2000:Dync1li1	UTSW	9	114713563	missense	probably benign	0.05
R2520:Dync1li1	UTSW	9	114689006	missense	probably null	0.17
R2912:Dync1li1	UTSW	9	114715675	missense	probably benign	0.31
R4418:Dync1li1	UTSW	9	114706170	missense	probably damaging	1.00
R4422:Dync1li1	UTSW	9	114709309	missense	probably damaging	1.00
R4646:Dync1li1	UTSW	9	114709169	missense	probably damaging	0.96
R4693:Dync1li1	UTSW	9	114706098	missense	probably damaging	0.99
R4817:Dync1li1	UTSW	9	114705094	missense	probably benign	0.09
R5027:Dync1li1	UTSW	9	114713544	missense	probably damaging	1.00
R5274:Dync1li1	UTSW	9	114715205	missense	possibly damaging	0.84
R5363:Dync1li1	UTSW	9	114715229	missense	probably damaging	0.99
R5902:Dync1li1	UTSW	9	114717861	critical splice acceptor site	probably null
R6359:Dync1li1	UTSW	9	114713570	missense	probably benign	0.29
R7235:Dync1li1	UTSW	9	114715163	missense	possibly damaging	0.58
R8161:Dync1li1	UTSW	9	114706183	missense	probably damaging	1.00
R8191:Dync1li1	UTSW	9	114709185	missense	probably benign	0.02
R8703:Dync1li1	UTSW	9	114723261	missense	probably damaging	0.98
R8733:Dync1li1	UTSW	9	114705110	missense	probably damaging	0.97
R9211:Dync1li1	UTSW	9	114688944	nonsense	probably null
R9307:Dync1li1	UTSW	9	114706008	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGCTCACATGGTTCCATTTC -3'
(R):5'- AACACTTCAGCAGGGTGGTAG -3'

Sequencing Primer
(F):5'- GGCTCACATGGTTCCATTTCTAAAC -3'
(R):5'- TGGTTCTACCATCCAGAGACCAG -3'

Posted On

2019-11-26