Incidental Mutation 'R7757:Ckap4'
ID 597628
Institutional Source Beutler Lab
Gene Symbol Ckap4
Ensembl Gene ENSMUSG00000046841
Gene Name cytoskeleton-associated protein 4
Synonyms CLIMP-63, 5630400A09Rik, P63
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock # R7757 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 84526305-84534062 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84528467 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 244 (E244G)
Ref Sequence ENSEMBL: ENSMUSP00000050336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053871] [ENSMUST00000167671]
AlphaFold Q8BMK4
Predicted Effect probably damaging
Transcript: ENSMUST00000053871
AA Change: E244G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050336
Gene: ENSMUSG00000046841
AA Change: E244G

DomainStartEndE-ValueType
low complexity region 36 59 N/A INTRINSIC
low complexity region 64 82 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
internal_repeat_1 191 233 1.28e-5 PROSPERO
internal_repeat_1 269 311 1.28e-5 PROSPERO
coiled coil region 338 362 N/A INTRINSIC
coiled coil region 408 438 N/A INTRINSIC
low complexity region 476 489 N/A INTRINSIC
coiled coil region 537 575 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167671
AA Change: E244G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130304
Gene: ENSMUSG00000046841
AA Change: E244G

DomainStartEndE-ValueType
low complexity region 36 59 N/A INTRINSIC
low complexity region 64 82 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
internal_repeat_1 191 233 1.28e-5 PROSPERO
internal_repeat_1 269 311 1.28e-5 PROSPERO
coiled coil region 338 362 N/A INTRINSIC
coiled coil region 408 438 N/A INTRINSIC
low complexity region 476 489 N/A INTRINSIC
coiled coil region 537 575 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A T 15: 8,252,227 E2850V unknown Het
2700049A03Rik G A 12: 71,189,413 M1179I probably benign Het
6430550D23Rik T C 2: 156,003,431 T18A possibly damaging Het
Acox2 T C 14: 8,230,166 N659S probably damaging Het
Agk T C 6: 40,376,278 V192A possibly damaging Het
Ap3b1 T A 13: 94,528,158 probably null Het
Bche T A 3: 73,701,121 D324V probably damaging Het
Bsn A G 9: 108,114,740 I1271T possibly damaging Het
Capn12 T C 7: 28,882,821 L120P probably damaging Het
Cep290 T A 10: 100,563,434 S2273T probably benign Het
Clcn7 T C 17: 25,156,822 Y545H probably damaging Het
Cmya5 T A 13: 93,098,272 T103S possibly damaging Het
Cpne9 G A 6: 113,284,445 V121M possibly damaging Het
Csmd2 T A 4: 128,483,456 I2043N Het
Disc1 A G 8: 125,087,504 T36A probably benign Het
Disp2 T C 2: 118,790,910 Y708H probably damaging Het
Dnah3 A G 7: 120,071,570 V635A probably benign Het
Dnah3 A T 7: 119,971,215 probably null Het
Dync1li1 A G 9: 114,709,277 H234R possibly damaging Het
Egfr T C 11: 16,889,966 V660A possibly damaging Het
Epb42 T C 2: 121,027,719 R253G possibly damaging Het
Fat2 T A 11: 55,311,421 T276S probably benign Het
Fcho2 A G 13: 98,764,503 probably null Het
Ginm1 A T 10: 7,779,355 I41N probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm49368 C T 7: 128,112,226 R701C probably damaging Het
Gpr37 T A 6: 25,688,208 I297F probably benign Het
Gprc5a T A 6: 135,079,344 I263N possibly damaging Het
Gys2 A T 6: 142,454,451 S345T probably benign Het
Hk2 T C 6: 82,742,915 M255V possibly damaging Het
Ibtk A C 9: 85,697,237 S1202A possibly damaging Het
Il23r T G 6: 67,423,981 D455A probably benign Het
Irs2 T A 8: 11,006,522 K637* probably null Het
Jak2 T C 19: 29,283,546 V314A probably benign Het
Mei1 C T 15: 82,082,623 probably benign Het
Mill1 T C 7: 18,262,466 M69T probably benign Het
Mms22l T C 4: 24,598,884 probably null Het
Mup8 C A 4: 60,220,332 Q133H probably benign Het
Mup8 T A 4: 60,220,333 Q133L probably benign Het
Mycbp2 A T 14: 103,191,619 Y2374N probably damaging Het
Nbeal1 A T 1: 60,257,450 K1166N probably damaging Het
Nlrc4 T A 17: 74,448,196 R8S probably benign Het
Nrcam C T 12: 44,549,898 Q25* probably null Het
Nudt16 A C 9: 105,131,561 M47R probably damaging Het
Nup62 T C 7: 44,828,995 S145P probably benign Het
Olfr1222 T C 2: 89,124,989 I247M possibly damaging Het
Olfr959 A G 9: 39,572,465 W265R probably benign Het
Osbpl1a A T 18: 12,933,600 V34D probably benign Het
Otogl T A 10: 107,876,921 N521Y probably damaging Het
Pcdhb14 T A 18: 37,449,834 D664E possibly damaging Het
Pex5l T C 3: 33,082,151 probably benign Het
Pkhd1 A G 1: 20,562,415 L592P probably damaging Het
Plxdc2 A G 2: 16,729,376 H480R probably benign Het
Rnf216 T A 5: 143,080,236 K532N probably damaging Het
Schip1 C A 3: 68,617,695 Q358K probably damaging Het
Sdc2 A T 15: 33,028,087 E117V possibly damaging Het
Sept11 A T 5: 93,171,464 probably null Het
Shprh A T 10: 11,162,180 E420V probably benign Het
Ska1 T A 18: 74,196,973 H232L probably benign Het
Slc36a4 A G 9: 15,719,660 N25S possibly damaging Het
Slitrk3 G A 3: 73,050,839 T200M probably damaging Het
Smad2 C T 18: 76,288,013 H138Y probably benign Het
Snx21 T C 2: 164,786,165 S34P probably damaging Het
Sos2 A G 12: 69,648,585 V126A probably damaging Het
Srcap C T 7: 127,530,794 T596I probably damaging Het
Stk31 T G 6: 49,406,943 probably null Het
Stox1 T C 10: 62,663,964 D939G probably damaging Het
Syne2 G T 12: 76,061,779 C979F possibly damaging Het
Tanc2 C A 11: 105,776,858 N88K possibly damaging Het
Tll2 A T 19: 41,096,008 V677E probably damaging Het
Ttn T C 2: 76,918,490 T4072A probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Unc13b AGAGCC AGAGCCCGAGCC 4: 43,177,330 probably benign Het
Unc13b CAGAGC CAGAGCGAGAGC 4: 43,177,341 probably benign Het
Vmn2r43 A T 7: 8,255,254 F320Y possibly damaging Het
Zscan4f G T 7: 11,401,278 G204* probably null Het
Other mutations in Ckap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02591:Ckap4 APN 10 84528590 missense probably damaging 1.00
IGL03251:Ckap4 APN 10 84528605 missense probably damaging 1.00
PIT1430001:Ckap4 UTSW 10 84527766 missense probably damaging 0.99
R0866:Ckap4 UTSW 10 84527520 missense probably damaging 1.00
R1462:Ckap4 UTSW 10 84527567 missense probably damaging 1.00
R1462:Ckap4 UTSW 10 84527567 missense probably damaging 1.00
R1734:Ckap4 UTSW 10 84527874 missense probably benign
R2113:Ckap4 UTSW 10 84533523 missense possibly damaging 0.79
R3723:Ckap4 UTSW 10 84528392 missense probably damaging 1.00
R3958:Ckap4 UTSW 10 84528164 missense probably benign 0.01
R4735:Ckap4 UTSW 10 84533520 missense possibly damaging 0.69
R4746:Ckap4 UTSW 10 84533520 missense possibly damaging 0.69
R4857:Ckap4 UTSW 10 84533488 missense possibly damaging 0.73
R5308:Ckap4 UTSW 10 84528374 missense probably benign 0.01
R5333:Ckap4 UTSW 10 84527610 missense probably damaging 1.00
R5848:Ckap4 UTSW 10 84533490 missense probably benign 0.02
R7383:Ckap4 UTSW 10 84528284 missense probably damaging 1.00
R7402:Ckap4 UTSW 10 84527999 missense probably damaging 0.99
R7453:Ckap4 UTSW 10 84528599 missense probably damaging 1.00
R7966:Ckap4 UTSW 10 84527585 missense probably damaging 1.00
R8098:Ckap4 UTSW 10 84533635 missense probably damaging 0.96
R8337:Ckap4 UTSW 10 84528596 missense probably damaging 1.00
R8932:Ckap4 UTSW 10 84528426 missense probably benign 0.29
R9099:Ckap4 UTSW 10 84533538 missense probably damaging 0.99
R9115:Ckap4 UTSW 10 84527643 missense probably damaging 1.00
R9193:Ckap4 UTSW 10 84527486 missense probably damaging 1.00
R9432:Ckap4 UTSW 10 84527679 missense probably damaging 1.00
R9462:Ckap4 UTSW 10 84528060 missense possibly damaging 0.92
R9592:Ckap4 UTSW 10 84528311 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTGAGGCTCACCAGTTC -3'
(R):5'- GCGAAGTTCTACAGAAGTTGCAG -3'

Sequencing Primer
(F):5'- CTCTGTGTAGACGTCGGACTC -3'
(R):5'- GAATGAGATTCTCAAAGATCTGTCGG -3'
Posted On 2019-11-26