Incidental Mutation 'R7757:Cep290'
ID597629
Institutional Source Beutler Lab
Gene Symbol Cep290
Ensembl Gene ENSMUSG00000019971
Gene Namecentrosomal protein 290
Synonymsb2b1454Clo, Nphp6, b2b1752Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R7757 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location100487558-100574840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100563434 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 2273 (S2273T)
Ref Sequence ENSEMBL: ENSMUSP00000130899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164751] [ENSMUST00000219765] [ENSMUST00000220346]
AlphaFold Q6A078
Predicted Effect probably benign
Transcript: ENSMUST00000164751
AA Change: S2273T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: S2273T

DomainStartEndE-ValueType
coiled coil region 59 298 N/A INTRINSIC
coiled coil region 319 566 N/A INTRINSIC
coiled coil region 598 662 N/A INTRINSIC
coiled coil region 697 754 N/A INTRINSIC
coiled coil region 780 875 N/A INTRINSIC
internal_repeat_2 884 894 1.1e-5 PROSPERO
coiled coil region 986 1028 N/A INTRINSIC
internal_repeat_2 1057 1067 1.1e-5 PROSPERO
coiled coil region 1071 1109 N/A INTRINSIC
low complexity region 1140 1156 N/A INTRINSIC
internal_repeat_1 1176 1206 8.72e-8 PROSPERO
coiled coil region 1221 1250 N/A INTRINSIC
Pfam:CEP209_CC5 1290 1417 3.8e-55 PFAM
low complexity region 1476 1493 N/A INTRINSIC
internal_repeat_1 1498 1525 8.72e-8 PROSPERO
coiled coil region 1535 1595 N/A INTRINSIC
coiled coil region 1624 1716 N/A INTRINSIC
coiled coil region 1776 2328 N/A INTRINSIC
low complexity region 2333 2347 N/A INTRINSIC
coiled coil region 2377 2453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219765
AA Change: S2266T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000220346
AA Change: S2273T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A T 15: 8,252,227 E2850V unknown Het
2700049A03Rik G A 12: 71,189,413 M1179I probably benign Het
6430550D23Rik T C 2: 156,003,431 T18A possibly damaging Het
Acox2 T C 14: 8,230,166 N659S probably damaging Het
Agk T C 6: 40,376,278 V192A possibly damaging Het
Ap3b1 T A 13: 94,528,158 probably null Het
Bche T A 3: 73,701,121 D324V probably damaging Het
Bsn A G 9: 108,114,740 I1271T possibly damaging Het
Capn12 T C 7: 28,882,821 L120P probably damaging Het
Ckap4 T C 10: 84,528,467 E244G probably damaging Het
Clcn7 T C 17: 25,156,822 Y545H probably damaging Het
Cmya5 T A 13: 93,098,272 T103S possibly damaging Het
Cpne9 G A 6: 113,284,445 V121M possibly damaging Het
Csmd2 T A 4: 128,483,456 I2043N Het
Disc1 A G 8: 125,087,504 T36A probably benign Het
Disp2 T C 2: 118,790,910 Y708H probably damaging Het
Dnah3 A G 7: 120,071,570 V635A probably benign Het
Dnah3 A T 7: 119,971,215 probably null Het
Dync1li1 A G 9: 114,709,277 H234R possibly damaging Het
Egfr T C 11: 16,889,966 V660A possibly damaging Het
Epb42 T C 2: 121,027,719 R253G possibly damaging Het
Fat2 T A 11: 55,311,421 T276S probably benign Het
Fcho2 A G 13: 98,764,503 probably null Het
Ginm1 A T 10: 7,779,355 I41N probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm49368 C T 7: 128,112,226 R701C probably damaging Het
Gpr37 T A 6: 25,688,208 I297F probably benign Het
Gprc5a T A 6: 135,079,344 I263N possibly damaging Het
Gys2 A T 6: 142,454,451 S345T probably benign Het
Hk2 T C 6: 82,742,915 M255V possibly damaging Het
Ibtk A C 9: 85,697,237 S1202A possibly damaging Het
Il23r T G 6: 67,423,981 D455A probably benign Het
Irs2 T A 8: 11,006,522 K637* probably null Het
Jak2 T C 19: 29,283,546 V314A probably benign Het
Mei1 C T 15: 82,082,623 probably benign Het
Mill1 T C 7: 18,262,466 M69T probably benign Het
Mms22l T C 4: 24,598,884 probably null Het
Mup8 C A 4: 60,220,332 Q133H probably benign Het
Mup8 T A 4: 60,220,333 Q133L probably benign Het
Mycbp2 A T 14: 103,191,619 Y2374N probably damaging Het
Nbeal1 A T 1: 60,257,450 K1166N probably damaging Het
Nlrc4 T A 17: 74,448,196 R8S probably benign Het
Nrcam C T 12: 44,549,898 Q25* probably null Het
Nudt16 A C 9: 105,131,561 M47R probably damaging Het
Nup62 T C 7: 44,828,995 S145P probably benign Het
Olfr1222 T C 2: 89,124,989 I247M possibly damaging Het
Olfr959 A G 9: 39,572,465 W265R probably benign Het
Osbpl1a A T 18: 12,933,600 V34D probably benign Het
Otogl T A 10: 107,876,921 N521Y probably damaging Het
Pcdhb14 T A 18: 37,449,834 D664E possibly damaging Het
Pex5l T C 3: 33,082,151 probably benign Het
Pkhd1 A G 1: 20,562,415 L592P probably damaging Het
Plxdc2 A G 2: 16,729,376 H480R probably benign Het
Rnf216 T A 5: 143,080,236 K532N probably damaging Het
Schip1 C A 3: 68,617,695 Q358K probably damaging Het
Sdc2 A T 15: 33,028,087 E117V possibly damaging Het
Sept11 A T 5: 93,171,464 probably null Het
Shprh A T 10: 11,162,180 E420V probably benign Het
Ska1 T A 18: 74,196,973 H232L probably benign Het
Slc36a4 A G 9: 15,719,660 N25S possibly damaging Het
Slitrk3 G A 3: 73,050,839 T200M probably damaging Het
Smad2 C T 18: 76,288,013 H138Y probably benign Het
Snx21 T C 2: 164,786,165 S34P probably damaging Het
Sos2 A G 12: 69,648,585 V126A probably damaging Het
Srcap C T 7: 127,530,794 T596I probably damaging Het
Stk31 T G 6: 49,406,943 probably null Het
Stox1 T C 10: 62,663,964 D939G probably damaging Het
Syne2 G T 12: 76,061,779 C979F possibly damaging Het
Tanc2 C A 11: 105,776,858 N88K possibly damaging Het
Tll2 A T 19: 41,096,008 V677E probably damaging Het
Ttn T C 2: 76,918,490 T4072A probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Unc13b AGAGCC AGAGCCCGAGCC 4: 43,177,330 probably benign Het
Unc13b CAGAGC CAGAGCGAGAGC 4: 43,177,341 probably benign Het
Vmn2r43 A T 7: 8,255,254 F320Y possibly damaging Het
Zscan4f G T 7: 11,401,278 G204* probably null Het
Other mutations in Cep290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cep290 APN 10 100508724 missense probably benign 0.00
IGL00499:Cep290 APN 10 100543327 missense probably damaging 1.00
IGL00547:Cep290 APN 10 100510708 missense probably damaging 0.99
IGL00573:Cep290 APN 10 100540361 missense probably damaging 1.00
IGL00646:Cep290 APN 10 100501154 missense probably benign 0.15
IGL00755:Cep290 APN 10 100531104 missense probably damaging 1.00
IGL00835:Cep290 APN 10 100563380 nonsense probably null
IGL00846:Cep290 APN 10 100540333 splice site probably benign
IGL00985:Cep290 APN 10 100567161 splice site probably benign
IGL01687:Cep290 APN 10 100500205 missense probably damaging 1.00
IGL01782:Cep290 APN 10 100545125 nonsense probably null
IGL02010:Cep290 APN 10 100508707 missense probably benign 0.39
IGL02010:Cep290 APN 10 100561345 missense probably benign 0.00
IGL02036:Cep290 APN 10 100558100 nonsense probably null
IGL02039:Cep290 APN 10 100514602 critical splice donor site probably null
IGL02532:Cep290 APN 10 100545065 missense probably benign 0.04
IGL02950:Cep290 APN 10 100540329 splice site probably benign
IGL03105:Cep290 APN 10 100551824 missense possibly damaging 0.66
IGL03179:Cep290 APN 10 100568088 missense possibly damaging 0.60
IGL03271:Cep290 APN 10 100537801 missense probably benign 0.09
IGL03401:Cep290 APN 10 100500265 missense probably benign 0.27
PIT4687001:Cep290 UTSW 10 100537591 missense probably benign 0.28
R0025:Cep290 UTSW 10 100537831 missense probably damaging 1.00
R0127:Cep290 UTSW 10 100536925 splice site probably benign
R0254:Cep290 UTSW 10 100514574 missense probably benign 0.31
R0295:Cep290 UTSW 10 100537821 missense probably damaging 0.99
R0371:Cep290 UTSW 10 100518564 splice site probably benign
R0390:Cep290 UTSW 10 100508758 missense probably benign 0.09
R0399:Cep290 UTSW 10 100554400 splice site probably benign
R0413:Cep290 UTSW 10 100523314 nonsense probably null
R0427:Cep290 UTSW 10 100516179 missense probably benign 0.01
R0472:Cep290 UTSW 10 100551455 missense probably benign 0.19
R0485:Cep290 UTSW 10 100549344 missense possibly damaging 0.94
R0635:Cep290 UTSW 10 100492676 missense probably damaging 1.00
R0675:Cep290 UTSW 10 100568813 critical splice acceptor site probably null
R0972:Cep290 UTSW 10 100518762 missense probably benign 0.08
R1238:Cep290 UTSW 10 100517863 missense probably damaging 1.00
R1297:Cep290 UTSW 10 100539100 splice site probably benign
R1368:Cep290 UTSW 10 100494966 splice site probably benign
R1394:Cep290 UTSW 10 100537529 missense possibly damaging 0.66
R1437:Cep290 UTSW 10 100572101 missense probably benign 0.00
R1493:Cep290 UTSW 10 100562181 missense probably benign 0.21
R1496:Cep290 UTSW 10 100538966 missense probably damaging 1.00
R1539:Cep290 UTSW 10 100496828 missense probably benign 0.06
R1598:Cep290 UTSW 10 100549329 missense probably damaging 1.00
R1616:Cep290 UTSW 10 100568836 missense probably benign
R1712:Cep290 UTSW 10 100554499 missense probably benign 0.02
R1753:Cep290 UTSW 10 100513981 missense probably benign
R1773:Cep290 UTSW 10 100510573 missense probably benign
R1775:Cep290 UTSW 10 100496810 missense probably damaging 0.98
R1799:Cep290 UTSW 10 100516196 missense probably benign 0.00
R1937:Cep290 UTSW 10 100497953 missense possibly damaging 0.71
R1991:Cep290 UTSW 10 100531184 missense possibly damaging 0.80
R2031:Cep290 UTSW 10 100512400 critical splice donor site probably null
R2164:Cep290 UTSW 10 100518795 missense probably damaging 0.96
R2393:Cep290 UTSW 10 100561238 critical splice acceptor site probably null
R2403:Cep290 UTSW 10 100537437 missense probably benign 0.19
R3612:Cep290 UTSW 10 100541581 nonsense probably null
R3800:Cep290 UTSW 10 100572941 missense probably damaging 0.97
R4005:Cep290 UTSW 10 100539008 missense probably damaging 1.00
R4039:Cep290 UTSW 10 100512401 critical splice donor site probably null
R4259:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4260:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4319:Cep290 UTSW 10 100539047 missense probably benign 0.09
R4329:Cep290 UTSW 10 100537668 missense probably damaging 0.98
R4573:Cep290 UTSW 10 100518850 missense probably benign
R4614:Cep290 UTSW 10 100508740 missense probably benign
R4614:Cep290 UTSW 10 100559687 missense possibly damaging 0.93
R4708:Cep290 UTSW 10 100523264 missense probably benign 0.02
R4727:Cep290 UTSW 10 100563270 missense probably benign 0.05
R4825:Cep290 UTSW 10 100488348 missense probably damaging 0.96
R4839:Cep290 UTSW 10 100508786 missense probably damaging 0.99
R4858:Cep290 UTSW 10 100494911 missense probably benign 0.31
R4871:Cep290 UTSW 10 100548914 missense probably benign 0.22
R5094:Cep290 UTSW 10 100567030 missense probably damaging 0.97
R5103:Cep290 UTSW 10 100539020 missense probably damaging 1.00
R5499:Cep290 UTSW 10 100537653 missense probably damaging 0.99
R5505:Cep290 UTSW 10 100499186 critical splice donor site probably null
R5615:Cep290 UTSW 10 100531150 missense probably damaging 1.00
R5815:Cep290 UTSW 10 100558108 missense possibly damaging 0.80
R5883:Cep290 UTSW 10 100523399 missense probably benign 0.44
R5889:Cep290 UTSW 10 100499074 missense possibly damaging 0.95
R5928:Cep290 UTSW 10 100551830 missense probably damaging 0.99
R5992:Cep290 UTSW 10 100543321 missense possibly damaging 0.73
R6000:Cep290 UTSW 10 100541787 missense probably damaging 1.00
R6213:Cep290 UTSW 10 100523360 missense probably benign 0.06
R6274:Cep290 UTSW 10 100530207 missense probably damaging 1.00
R6285:Cep290 UTSW 10 100523329 missense probably benign 0.17
R6306:Cep290 UTSW 10 100531166 missense possibly damaging 0.89
R6593:Cep290 UTSW 10 100508776 missense probably benign 0.01
R6649:Cep290 UTSW 10 100518531 missense probably benign 0.28
R6692:Cep290 UTSW 10 100569144 splice site probably null
R6788:Cep290 UTSW 10 100488628 missense probably damaging 1.00
R6847:Cep290 UTSW 10 100563419 missense probably damaging 1.00
R6947:Cep290 UTSW 10 100530056 missense probably damaging 1.00
R7035:Cep290 UTSW 10 100499071 missense probably benign 0.07
R7073:Cep290 UTSW 10 100539003 missense possibly damaging 0.90
R7114:Cep290 UTSW 10 100543358 missense probably damaging 0.98
R7256:Cep290 UTSW 10 100546498 missense probably damaging 1.00
R7258:Cep290 UTSW 10 100499108 missense probably benign 0.01
R7311:Cep290 UTSW 10 100537718 missense probably damaging 0.98
R7505:Cep290 UTSW 10 100516265 missense probably benign 0.01
R7615:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7643:Cep290 UTSW 10 100537553 missense probably benign
R7662:Cep290 UTSW 10 100537803 missense probably benign 0.21
R7663:Cep290 UTSW 10 100554536 critical splice donor site probably null
R7685:Cep290 UTSW 10 100540057 missense probably benign 0.19
R7699:Cep290 UTSW 10 100540369 missense probably benign 0.33
R7717:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7747:Cep290 UTSW 10 100558176 nonsense probably null
R7843:Cep290 UTSW 10 100516188 missense possibly damaging 0.49
R7905:Cep290 UTSW 10 100554490 missense probably benign
R8078:Cep290 UTSW 10 100572887 missense probably benign 0.04
R8081:Cep290 UTSW 10 100558176 nonsense probably null
R8094:Cep290 UTSW 10 100544931 missense possibly damaging 0.95
R8266:Cep290 UTSW 10 100559671 missense probably benign 0.08
R8305:Cep290 UTSW 10 100544934 missense probably benign 0.09
R8325:Cep290 UTSW 10 100517808 missense probably benign 0.03
R8372:Cep290 UTSW 10 100549341 missense probably benign 0.00
R8443:Cep290 UTSW 10 100495844 missense possibly damaging 0.80
R8497:Cep290 UTSW 10 100551458 missense probably damaging 1.00
R8778:Cep290 UTSW 10 100514512 nonsense probably null
R8975:Cep290 UTSW 10 100513920 missense possibly damaging 0.54
R9146:Cep290 UTSW 10 100541803 missense probably benign 0.44
Z1176:Cep290 UTSW 10 100549374 critical splice donor site probably benign
Z1177:Cep290 UTSW 10 100497944 missense probably benign
Z1177:Cep290 UTSW 10 100538997 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CACGGATAGGAAATAGAAGCCTCTG -3'
(R):5'- CACAGGTTTGCGATGTTCTG -3'

Sequencing Primer
(F):5'- CCTCTGAGAAACTGCGGATAG -3'
(R):5'- CCACACTAGCTAGGAAAGAGTCTTG -3'
Posted On2019-11-26