Incidental Mutation 'R7757:Egfr'
ID 597631
Institutional Source Beutler Lab
Gene Symbol Egfr
Ensembl Gene ENSMUSG00000020122
Gene Name epidermal growth factor receptor
Synonyms 9030024J15Rik, avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, Errb1, Erbb
MMRRC Submission 045813-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.933) question?
Stock # R7757 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 16702203-16868158 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 16839966 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 660 (V660A)
Ref Sequence ENSEMBL: ENSMUSP00000020329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020329] [ENSMUST00000102884]
AlphaFold Q01279
Predicted Effect possibly damaging
Transcript: ENSMUST00000020329
AA Change: V660A

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122
AA Change: V660A

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 1.4e-32 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 1.8e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.05e1 SMART
low complexity region 677 694 N/A INTRINSIC
TyrKc 714 970 2.88e-129 SMART
low complexity region 1004 1017 N/A INTRINSIC
low complexity region 1027 1048 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102884
SMART Domains Protein: ENSMUSP00000099948
Gene: ENSMUSG00000020122

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 5e-33 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 2e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.54e0 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,236,187 (GRCm39) M1179I probably benign Het
6430550D23Rik T C 2: 155,845,351 (GRCm39) T18A possibly damaging Het
Acox2 T C 14: 8,230,166 (GRCm38) N659S probably damaging Het
Agk T C 6: 40,353,212 (GRCm39) V192A possibly damaging Het
Ap3b1 T A 13: 94,664,666 (GRCm39) probably null Het
Bche T A 3: 73,608,454 (GRCm39) D324V probably damaging Het
Bsn A G 9: 107,991,939 (GRCm39) I1271T possibly damaging Het
Capn12 T C 7: 28,582,246 (GRCm39) L120P probably damaging Het
Cep290 T A 10: 100,399,296 (GRCm39) S2273T probably benign Het
Ckap4 T C 10: 84,364,331 (GRCm39) E244G probably damaging Het
Clcn7 T C 17: 25,375,796 (GRCm39) Y545H probably damaging Het
Cmya5 T A 13: 93,234,780 (GRCm39) T103S possibly damaging Het
Cplane1 A T 15: 8,281,711 (GRCm39) E2850V unknown Het
Cpne9 G A 6: 113,261,406 (GRCm39) V121M possibly damaging Het
Csmd2 T A 4: 128,377,249 (GRCm39) I2043N Het
Disc1 A G 8: 125,814,243 (GRCm39) T36A probably benign Het
Disp2 T C 2: 118,621,391 (GRCm39) Y708H probably damaging Het
Dnah3 A G 7: 119,670,793 (GRCm39) V635A probably benign Het
Dnah3 A T 7: 119,570,438 (GRCm39) probably null Het
Dync1li1 A G 9: 114,538,345 (GRCm39) H234R possibly damaging Het
Epb42 T C 2: 120,858,200 (GRCm39) R253G possibly damaging Het
Fat2 T A 11: 55,202,247 (GRCm39) T276S probably benign Het
Fcho2 A G 13: 98,901,011 (GRCm39) probably null Het
Ginm1 A T 10: 7,655,119 (GRCm39) I41N probably damaging Het
Gm4744 A G 6: 40,927,367 (GRCm39) probably benign Het
Gm49368 C T 7: 127,711,398 (GRCm39) R701C probably damaging Het
Gpr37 T A 6: 25,688,207 (GRCm39) I297F probably benign Het
Gprc5a T A 6: 135,056,342 (GRCm39) I263N possibly damaging Het
Gys2 A T 6: 142,400,177 (GRCm39) S345T probably benign Het
Hk2 T C 6: 82,719,896 (GRCm39) M255V possibly damaging Het
Ibtk A C 9: 85,579,290 (GRCm39) S1202A possibly damaging Het
Il23r T G 6: 67,400,965 (GRCm39) D455A probably benign Het
Irs2 T A 8: 11,056,522 (GRCm39) K637* probably null Het
Jak2 T C 19: 29,260,946 (GRCm39) V314A probably benign Het
Mei1 C T 15: 81,966,824 (GRCm39) probably benign Het
Mill1 T C 7: 17,996,391 (GRCm39) M69T probably benign Het
Mms22l T C 4: 24,598,884 (GRCm39) probably null Het
Mup8 C A 4: 60,220,332 (GRCm39) Q133H probably benign Het
Mup8 T A 4: 60,220,333 (GRCm39) Q133L probably benign Het
Mycbp2 A T 14: 103,429,055 (GRCm39) Y2374N probably damaging Het
Nbeal1 A T 1: 60,296,609 (GRCm39) K1166N probably damaging Het
Nlrc4 T A 17: 74,755,191 (GRCm39) R8S probably benign Het
Nrcam C T 12: 44,596,681 (GRCm39) Q25* probably null Het
Nudt16 A C 9: 105,008,760 (GRCm39) M47R probably damaging Het
Nup62 T C 7: 44,478,419 (GRCm39) S145P probably benign Het
Or10d1 A G 9: 39,483,761 (GRCm39) W265R probably benign Het
Or4c117 T C 2: 88,955,333 (GRCm39) I247M possibly damaging Het
Osbpl1a A T 18: 13,066,657 (GRCm39) V34D probably benign Het
Otogl T A 10: 107,712,782 (GRCm39) N521Y probably damaging Het
Pcdhb14 T A 18: 37,582,887 (GRCm39) D664E possibly damaging Het
Pex5l T C 3: 33,136,300 (GRCm39) probably benign Het
Pkhd1 A G 1: 20,632,639 (GRCm39) L592P probably damaging Het
Plxdc2 A G 2: 16,734,187 (GRCm39) H480R probably benign Het
Rnf216 T A 5: 143,065,991 (GRCm39) K532N probably damaging Het
Schip1 C A 3: 68,525,028 (GRCm39) Q358K probably damaging Het
Sdc2 A T 15: 33,028,233 (GRCm39) E117V possibly damaging Het
Septin11 A T 5: 93,319,323 (GRCm39) probably null Het
Shprh A T 10: 11,037,924 (GRCm39) E420V probably benign Het
Ska1 T A 18: 74,330,044 (GRCm39) H232L probably benign Het
Slc36a4 A G 9: 15,630,956 (GRCm39) N25S possibly damaging Het
Slitrk3 G A 3: 72,958,172 (GRCm39) T200M probably damaging Het
Smad2 C T 18: 76,421,084 (GRCm39) H138Y probably benign Het
Snx21 T C 2: 164,628,085 (GRCm39) S34P probably damaging Het
Sos2 A G 12: 69,695,359 (GRCm39) V126A probably damaging Het
Srcap C T 7: 127,129,966 (GRCm39) T596I probably damaging Het
Stk31 T G 6: 49,383,877 (GRCm39) probably null Het
Stox1 T C 10: 62,499,743 (GRCm39) D939G probably damaging Het
Syne2 G T 12: 76,108,553 (GRCm39) C979F possibly damaging Het
Tanc2 C A 11: 105,667,684 (GRCm39) N88K possibly damaging Het
Tll2 A T 19: 41,084,447 (GRCm39) V677E probably damaging Het
Ttn T C 2: 76,748,834 (GRCm39) T4072A probably benign Het
Unc13b CAGAGC CAGAGCGAGAGC 4: 43,177,341 (GRCm39) probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 (GRCm39) probably benign Het
Unc13b AGAGCC AGAGCCCGAGCC 4: 43,177,330 (GRCm39) probably benign Het
Vmn2r43 A T 7: 8,258,253 (GRCm39) F320Y possibly damaging Het
Zscan4f G T 7: 11,135,205 (GRCm39) G204* probably null Het
Other mutations in Egfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Egfr APN 11 16,813,020 (GRCm39) missense probably damaging 1.00
IGL01529:Egfr APN 11 16,813,014 (GRCm39) missense probably benign
IGL01556:Egfr APN 11 16,855,382 (GRCm39) missense probably damaging 1.00
IGL02627:Egfr APN 11 16,819,346 (GRCm39) missense probably damaging 1.00
IGL02862:Egfr APN 11 16,833,562 (GRCm39) missense probably benign 0.25
IGL02945:Egfr APN 11 16,702,514 (GRCm39) missense probably damaging 1.00
IGL02994:Egfr APN 11 16,861,811 (GRCm39) missense probably damaging 1.00
IGL03395:Egfr APN 11 16,860,261 (GRCm39) splice site probably benign
set UTSW 11 16,821,881 (GRCm39) splice site probably benign
Velvet UTSW 11 16,854,399 (GRCm39) missense probably damaging 1.00
PIT1430001:Egfr UTSW 11 16,860,214 (GRCm39) missense probably benign 0.00
R0196:Egfr UTSW 11 16,861,746 (GRCm39) missense probably benign 0.02
R0513:Egfr UTSW 11 16,822,855 (GRCm39) missense probably damaging 1.00
R0567:Egfr UTSW 11 16,822,873 (GRCm39) missense probably benign 0.01
R0629:Egfr UTSW 11 16,819,333 (GRCm39) missense probably damaging 1.00
R0961:Egfr UTSW 11 16,812,964 (GRCm39) missense probably damaging 1.00
R1163:Egfr UTSW 11 16,833,546 (GRCm39) missense probably benign 0.02
R1454:Egfr UTSW 11 16,839,920 (GRCm39) missense probably benign
R1456:Egfr UTSW 11 16,813,065 (GRCm39) missense probably benign 0.00
R1503:Egfr UTSW 11 16,819,301 (GRCm39) missense possibly damaging 0.86
R1577:Egfr UTSW 11 16,819,241 (GRCm39) missense probably benign 0.04
R1595:Egfr UTSW 11 16,856,847 (GRCm39) missense probably damaging 0.99
R1699:Egfr UTSW 11 16,809,019 (GRCm39) missense probably benign 0.14
R2172:Egfr UTSW 11 16,861,562 (GRCm39) missense probably benign 0.00
R3690:Egfr UTSW 11 16,821,881 (GRCm39) splice site probably benign
R3922:Egfr UTSW 11 16,831,495 (GRCm39) missense probably damaging 1.00
R4444:Egfr UTSW 11 16,821,027 (GRCm39) missense probably benign 0.00
R4685:Egfr UTSW 11 16,808,980 (GRCm39) missense probably damaging 1.00
R4737:Egfr UTSW 11 16,819,231 (GRCm39) missense probably damaging 0.99
R4814:Egfr UTSW 11 16,819,354 (GRCm39) missense probably damaging 1.00
R4841:Egfr UTSW 11 16,861,607 (GRCm39) missense probably benign 0.05
R4842:Egfr UTSW 11 16,861,607 (GRCm39) missense probably benign 0.05
R4903:Egfr UTSW 11 16,858,949 (GRCm39) missense probably damaging 1.00
R4964:Egfr UTSW 11 16,858,949 (GRCm39) missense probably damaging 1.00
R4985:Egfr UTSW 11 16,809,029 (GRCm39) nonsense probably null
R4998:Egfr UTSW 11 16,831,493 (GRCm39) missense possibly damaging 0.58
R5001:Egfr UTSW 11 16,854,434 (GRCm39) missense probably damaging 0.98
R5304:Egfr UTSW 11 16,834,260 (GRCm39) missense probably benign
R5309:Egfr UTSW 11 16,861,703 (GRCm39) missense probably benign 0.00
R5653:Egfr UTSW 11 16,861,617 (GRCm39) missense probably benign 0.04
R5905:Egfr UTSW 11 16,861,494 (GRCm39) missense probably damaging 1.00
R6051:Egfr UTSW 11 16,833,607 (GRCm39) missense possibly damaging 0.87
R6052:Egfr UTSW 11 16,861,554 (GRCm39) missense probably benign 0.16
R6114:Egfr UTSW 11 16,854,374 (GRCm39) missense possibly damaging 0.46
R6261:Egfr UTSW 11 16,839,964 (GRCm39) missense probably benign 0.11
R6434:Egfr UTSW 11 16,819,294 (GRCm39) missense probably benign 0.25
R6475:Egfr UTSW 11 16,841,259 (GRCm39) missense probably benign
R6799:Egfr UTSW 11 16,846,952 (GRCm39) missense probably damaging 1.00
R7143:Egfr UTSW 11 16,821,627 (GRCm39) missense probably benign 0.20
R7195:Egfr UTSW 11 16,818,162 (GRCm39) missense probably damaging 1.00
R7459:Egfr UTSW 11 16,846,967 (GRCm39) missense probably damaging 1.00
R7612:Egfr UTSW 11 16,809,025 (GRCm39) missense possibly damaging 0.74
R7763:Egfr UTSW 11 16,841,266 (GRCm39) missense probably damaging 1.00
R8315:Egfr UTSW 11 16,825,027 (GRCm39) missense probably benign 0.08
R8320:Egfr UTSW 11 16,841,251 (GRCm39) missense probably damaging 1.00
R8324:Egfr UTSW 11 16,858,885 (GRCm39) missense probably damaging 0.98
R8324:Egfr UTSW 11 16,808,971 (GRCm39) missense probably damaging 0.99
R8347:Egfr UTSW 11 16,828,174 (GRCm39) missense probably damaging 1.00
R8440:Egfr UTSW 11 16,859,831 (GRCm39) missense probably damaging 1.00
R8511:Egfr UTSW 11 16,846,949 (GRCm39) missense probably damaging 1.00
R8708:Egfr UTSW 11 16,817,300 (GRCm39) critical splice donor site probably benign
R8804:Egfr UTSW 11 16,819,339 (GRCm39) missense probably benign 0.09
R8853:Egfr UTSW 11 16,858,885 (GRCm39) missense possibly damaging 0.93
R8906:Egfr UTSW 11 16,861,635 (GRCm39) missense probably damaging 1.00
R9177:Egfr UTSW 11 16,855,410 (GRCm39) missense probably damaging 1.00
R9268:Egfr UTSW 11 16,855,410 (GRCm39) missense probably damaging 1.00
R9335:Egfr UTSW 11 16,820,991 (GRCm39) missense probably damaging 1.00
R9417:Egfr UTSW 11 16,825,067 (GRCm39) nonsense probably null
R9454:Egfr UTSW 11 16,837,155 (GRCm39) missense probably damaging 1.00
Z1177:Egfr UTSW 11 16,819,319 (GRCm39) missense probably damaging 1.00
Z1177:Egfr UTSW 11 16,812,954 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AACCTTGCCTTGGGACTTAGC -3'
(R):5'- GTATGAAATCCCACGCTACAAATTC -3'

Sequencing Primer
(F):5'- TTGGGACTTAGCCACCAGTC -3'
(R):5'- ACGCTACAAATTCTCAAAGGAAG -3'
Posted On 2019-11-26