Mutagenetix > Incidental Mutation

Incidental Mutation 'R7757:Sos2'

597634

Institutional Source

Beutler Lab

Gene Symbol

Sos2

Ensembl Gene

ENSMUSG00000034801

Gene Name

SOS Ras/Rho guanine nucleotide exchange factor 2

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7757 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69583762-69681852 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 69648585 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 126 (V126A)

Ref Sequence

ENSEMBL: ENSMUSP00000138793 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035773] [ENSMUST00000182396] [ENSMUST00000183277]

AlphaFold

Q02384

PDB Structure

ORIENTATION OF PEPTIDE FRAGMENTS FROM SOS PROTEINS BOUND TO THE N-TERMINAL SH3 DOMAIN OF GRB2 DETERMINED BY NMR SPECTROSCOPY [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000035773
AA Change: V126A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000044866
Gene: ENSMUSG00000034801
AA Change: V126A

Domain	Start	End	E-Value	Type
Pfam:Histone	54	169	3.7e-13	PFAM
RhoGEF	203	388	1.98e-35	SMART
PH	443	547	1.54e-14	SMART
RasGEFN	595	740	5.8e-52	SMART
RasGEF	775	1019	2.51e-92	SMART
low complexity region	1079	1099	N/A	INTRINSIC
low complexity region	1144	1152	N/A	INTRINSIC
low complexity region	1173	1192	N/A	INTRINSIC
low complexity region	1200	1225	N/A	INTRINSIC
low complexity region	1254	1269	N/A	INTRINSIC
low complexity region	1276	1292	N/A	INTRINSIC
low complexity region	1301	1309	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000182396
AA Change: V126A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138589
Gene: ENSMUSG00000034801
AA Change: V126A

Domain	Start	End	E-Value	Type
Pfam:Histone	97	169	1e-9	PFAM
Pfam:RhoGEF	203	344	1.6e-12	PFAM
PH	410	514	1.54e-14	SMART
RasGEFN	562	707	5.8e-52	SMART
RasGEF	742	986	2.51e-92	SMART
low complexity region	1046	1066	N/A	INTRINSIC
low complexity region	1111	1119	N/A	INTRINSIC
low complexity region	1140	1159	N/A	INTRINSIC
low complexity region	1167	1192	N/A	INTRINSIC
low complexity region	1221	1236	N/A	INTRINSIC
low complexity region	1243	1259	N/A	INTRINSIC
low complexity region	1268	1276	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000183277
AA Change: V126A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000138793
Gene: ENSMUSG00000034801
AA Change: V126A

Domain	Start	End	E-Value	Type
Pfam:Histone	97	169	8.9e-11	PFAM
RhoGEF	203	388	1.98e-35	SMART
PH	443	547	1.54e-14	SMART
RasGEFN	595	740	5.8e-52	SMART
RasGEF	775	1019	2.51e-92	SMART
low complexity region	1079	1099	N/A	INTRINSIC
low complexity region	1144	1152	N/A	INTRINSIC
low complexity region	1173	1192	N/A	INTRINSIC
low complexity region	1200	1225	N/A	INTRINSIC
low complexity region	1254	1269	N/A	INTRINSIC
low complexity region	1276	1292	N/A	INTRINSIC
low complexity region	1301	1309	N/A	INTRINSIC

Meta Mutation Damage Score

0.5226

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

96% (70/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory protein that is involved in the positive regulation of ras proteins. Mutations in this gene are associated with Noonan Syndrome-9. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal embryonic and adult histopathology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	A	T	15: 8,252,227	E2850V	unknown	Het
2700049A03Rik	G	A	12: 71,189,413	M1179I	probably benign	Het
6430550D23Rik	T	C	2: 156,003,431	T18A	possibly damaging	Het
Acox2	T	C	14: 8,230,166	N659S	probably damaging	Het
Agk	T	C	6: 40,376,278	V192A	possibly damaging	Het
Ap3b1	T	A	13: 94,528,158		probably null	Het
Bche	T	A	3: 73,701,121	D324V	probably damaging	Het
Bsn	A	G	9: 108,114,740	I1271T	possibly damaging	Het
Capn12	T	C	7: 28,882,821	L120P	probably damaging	Het
Cep290	T	A	10: 100,563,434	S2273T	probably benign	Het
Ckap4	T	C	10: 84,528,467	E244G	probably damaging	Het
Clcn7	T	C	17: 25,156,822	Y545H	probably damaging	Het
Cmya5	T	A	13: 93,098,272	T103S	possibly damaging	Het
Cpne9	G	A	6: 113,284,445	V121M	possibly damaging	Het
Csmd2	T	A	4: 128,483,456	I2043N		Het
Disc1	A	G	8: 125,087,504	T36A	probably benign	Het
Disp2	T	C	2: 118,790,910	Y708H	probably damaging	Het
Dnah3	A	G	7: 120,071,570	V635A	probably benign	Het
Dnah3	A	T	7: 119,971,215		probably null	Het
Dync1li1	A	G	9: 114,709,277	H234R	possibly damaging	Het
Egfr	T	C	11: 16,889,966	V660A	possibly damaging	Het
Epb42	T	C	2: 121,027,719	R253G	possibly damaging	Het
Fat2	T	A	11: 55,311,421	T276S	probably benign	Het
Fcho2	A	G	13: 98,764,503		probably null	Het
Ginm1	A	T	10: 7,779,355	I41N	probably damaging	Het
Gm4744	A	G	6: 40,950,433		probably benign	Het
Gm49368	C	T	7: 128,112,226	R701C	probably damaging	Het
Gpr37	T	A	6: 25,688,208	I297F	probably benign	Het
Gprc5a	T	A	6: 135,079,344	I263N	possibly damaging	Het
Gys2	A	T	6: 142,454,451	S345T	probably benign	Het
Hk2	T	C	6: 82,742,915	M255V	possibly damaging	Het
Ibtk	A	C	9: 85,697,237	S1202A	possibly damaging	Het
Il23r	T	G	6: 67,423,981	D455A	probably benign	Het
Irs2	T	A	8: 11,006,522	K637*	probably null	Het
Jak2	T	C	19: 29,283,546	V314A	probably benign	Het
Mei1	C	T	15: 82,082,623		probably benign	Het
Mill1	T	C	7: 18,262,466	M69T	probably benign	Het
Mms22l	T	C	4: 24,598,884		probably null	Het
Mup8	C	A	4: 60,220,332	Q133H	probably benign	Het
Mup8	T	A	4: 60,220,333	Q133L	probably benign	Het
Mycbp2	A	T	14: 103,191,619	Y2374N	probably damaging	Het
Nbeal1	A	T	1: 60,257,450	K1166N	probably damaging	Het
Nlrc4	T	A	17: 74,448,196	R8S	probably benign	Het
Nrcam	C	T	12: 44,549,898	Q25*	probably null	Het
Nudt16	A	C	9: 105,131,561	M47R	probably damaging	Het
Nup62	T	C	7: 44,828,995	S145P	probably benign	Het
Olfr1222	T	C	2: 89,124,989	I247M	possibly damaging	Het
Olfr959	A	G	9: 39,572,465	W265R	probably benign	Het
Osbpl1a	A	T	18: 12,933,600	V34D	probably benign	Het
Otogl	T	A	10: 107,876,921	N521Y	probably damaging	Het
Pcdhb14	T	A	18: 37,449,834	D664E	possibly damaging	Het
Pex5l	T	C	3: 33,082,151		probably benign	Het
Pkhd1	A	G	1: 20,562,415	L592P	probably damaging	Het
Plxdc2	A	G	2: 16,729,376	H480R	probably benign	Het
Rnf216	T	A	5: 143,080,236	K532N	probably damaging	Het
Schip1	C	A	3: 68,617,695	Q358K	probably damaging	Het
Sdc2	A	T	15: 33,028,087	E117V	possibly damaging	Het
Sept11	A	T	5: 93,171,464		probably null	Het
Shprh	A	T	10: 11,162,180	E420V	probably benign	Het
Ska1	T	A	18: 74,196,973	H232L	probably benign	Het
Slc36a4	A	G	9: 15,719,660	N25S	possibly damaging	Het
Slitrk3	G	A	3: 73,050,839	T200M	probably damaging	Het
Smad2	C	T	18: 76,288,013	H138Y	probably benign	Het
Snx21	T	C	2: 164,786,165	S34P	probably damaging	Het
Srcap	C	T	7: 127,530,794	T596I	probably damaging	Het
Stk31	T	G	6: 49,406,943		probably null	Het
Stox1	T	C	10: 62,663,964	D939G	probably damaging	Het
Syne2	G	T	12: 76,061,779	C979F	possibly damaging	Het
Tanc2	C	A	11: 105,776,858	N88K	possibly damaging	Het
Tll2	A	T	19: 41,096,008	V677E	probably damaging	Het
Ttn	T	C	2: 76,918,490	T4072A	probably benign	Het
Unc13b	CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC	CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC	4: 43,177,312		probably benign	Het
Unc13b	AGAGCC	AGAGCCCGAGCC	4: 43,177,330		probably benign	Het
Unc13b	CAGAGC	CAGAGCGAGAGC	4: 43,177,341		probably benign	Het
Vmn2r43	A	T	7: 8,255,254	F320Y	possibly damaging	Het
Zscan4f	G	T	7: 11,401,278	G204*	probably null	Het

Other mutations in Sos2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01138:Sos2	APN	12	69616849	splice site	probably benign
IGL01348:Sos2	APN	12	69618092	missense	probably damaging	0.99
IGL01360:Sos2	APN	12	69590800	missense	probably benign	0.00
IGL01586:Sos2	APN	12	69607398	missense	probably damaging	1.00
IGL01721:Sos2	APN	12	69603867	missense	probably damaging	0.99
IGL02024:Sos2	APN	12	69618048	splice site	probably benign
IGL02347:Sos2	APN	12	69596746	missense	probably benign
IGL02419:Sos2	APN	12	69616990	missense	probably benign
IGL02684:Sos2	APN	12	69596666	missense	probably damaging	1.00
IGL02719:Sos2	APN	12	69617184	missense	probably benign	0.00
IGL03099:Sos2	APN	12	69616359	missense	probably damaging	1.00
Bechamel	UTSW	12	69603553	missense	probably damaging	1.00
sauce	UTSW	12	69596795	missense	probably damaging	1.00
G1citation:Sos2	UTSW	12	69650649	missense	probably damaging	1.00
PIT4131001:Sos2	UTSW	12	69618077	missense	probably benign
R0038:Sos2	UTSW	12	69596693	missense	probably damaging	1.00
R0233:Sos2	UTSW	12	69617330	missense	probably benign	0.00
R0233:Sos2	UTSW	12	69617330	missense	probably benign	0.00
R0326:Sos2	UTSW	12	69635685	missense	probably damaging	1.00
R1386:Sos2	UTSW	12	69614658	missense	probably damaging	1.00
R1472:Sos2	UTSW	12	69585316	splice site	probably null
R1534:Sos2	UTSW	12	69616955	missense	probably damaging	1.00
R1861:Sos2	UTSW	12	69617363	missense	probably damaging	1.00
R1934:Sos2	UTSW	12	69648541	missense	probably damaging	0.99
R1964:Sos2	UTSW	12	69616862	missense	possibly damaging	0.51
R2402:Sos2	UTSW	12	69596799	missense	possibly damaging	0.95
R2516:Sos2	UTSW	12	69650659	missense	probably damaging	0.99
R2571:Sos2	UTSW	12	69635718	missense	possibly damaging	0.95
R3423:Sos2	UTSW	12	69603553	missense	probably damaging	1.00
R4435:Sos2	UTSW	12	69614699	missense	possibly damaging	0.79
R4508:Sos2	UTSW	12	69635661	nonsense	probably null
R4595:Sos2	UTSW	12	69616889	missense	probably damaging	1.00
R4606:Sos2	UTSW	12	69614606	intron	probably benign
R4691:Sos2	UTSW	12	69616328	missense	probably damaging	1.00
R4716:Sos2	UTSW	12	69607371	missense	probably benign	0.04
R4863:Sos2	UTSW	12	69640154	missense	probably benign	0.04
R5179:Sos2	UTSW	12	69650728	nonsense	probably null
R5319:Sos2	UTSW	12	69627284	missense	probably benign	0.22
R5694:Sos2	UTSW	12	69590915	missense	probably damaging	0.96
R5877:Sos2	UTSW	12	69596795	missense	probably damaging	1.00
R6363:Sos2	UTSW	12	69632111	missense	probably benign	0.00
R6465:Sos2	UTSW	12	69596775	missense	probably benign	0.01
R6817:Sos2	UTSW	12	69618161	missense	probably benign	0.32
R6822:Sos2	UTSW	12	69650649	missense	probably damaging	1.00
R7015:Sos2	UTSW	12	69585235	missense	probably benign	0.43
R7562:Sos2	UTSW	12	69635638	missense	probably benign	0.12
R7570:Sos2	UTSW	12	69590880	missense	probably damaging	1.00
R7975:Sos2	UTSW	12	69593040	missense	probably benign	0.20
R8079:Sos2	UTSW	12	69607215	missense	probably damaging	1.00
R8194:Sos2	UTSW	12	69598824	missense	probably damaging	1.00
R8756:Sos2	UTSW	12	69648536	missense	probably damaging	1.00
R8775:Sos2	UTSW	12	69617232	missense	probably benign	0.02
R8775-TAIL:Sos2	UTSW	12	69617232	missense	probably benign	0.02
R9136:Sos2	UTSW	12	69586672	missense	possibly damaging	0.95
R9245:Sos2	UTSW	12	69648465	missense	probably damaging	1.00
Z1177:Sos2	UTSW	12	69585592	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTTTTACTCTATGTGAAATGTGG -3'
(R):5'- AGTGCAATCTTAGGCCTTGC -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- CTTTCGTCAGGCAAGGGCTTC -3'

Posted On

2019-11-26