Incidental Mutation 'R7757:Cmya5'
ID 597637
Institutional Source Beutler Lab
Gene Symbol Cmya5
Ensembl Gene ENSMUSG00000047419
Gene Name cardiomyopathy associated 5
Synonyms Myospryn, 2310076E16Rik, 2310076E21Rik
MMRRC Submission 045813-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.303) question?
Stock # R7757 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 93177221-93281232 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 93234780 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 103 (T103S)
Ref Sequence ENSEMBL: ENSMUSP00000050408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062122]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000062122
AA Change: T103S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: T103S

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
internal_repeat_1 448 535 5.09e-18 PROSPERO
internal_repeat_1 543 625 5.09e-18 PROSPERO
low complexity region 626 645 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 734 741 N/A INTRINSIC
low complexity region 1001 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1259 1267 N/A INTRINSIC
low complexity region 1440 1449 N/A INTRINSIC
low complexity region 1876 1889 N/A INTRINSIC
low complexity region 2632 2645 N/A INTRINSIC
low complexity region 3048 3057 N/A INTRINSIC
FN3 3312 3399 7.29e-4 SMART
FN3 3411 3492 1.3e0 SMART
Pfam:SPRY 3551 3668 6.7e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,236,187 (GRCm39) M1179I probably benign Het
6430550D23Rik T C 2: 155,845,351 (GRCm39) T18A possibly damaging Het
Acox2 T C 14: 8,230,166 (GRCm38) N659S probably damaging Het
Agk T C 6: 40,353,212 (GRCm39) V192A possibly damaging Het
Ap3b1 T A 13: 94,664,666 (GRCm39) probably null Het
Bche T A 3: 73,608,454 (GRCm39) D324V probably damaging Het
Bsn A G 9: 107,991,939 (GRCm39) I1271T possibly damaging Het
Capn12 T C 7: 28,582,246 (GRCm39) L120P probably damaging Het
Cep290 T A 10: 100,399,296 (GRCm39) S2273T probably benign Het
Ckap4 T C 10: 84,364,331 (GRCm39) E244G probably damaging Het
Clcn7 T C 17: 25,375,796 (GRCm39) Y545H probably damaging Het
Cplane1 A T 15: 8,281,711 (GRCm39) E2850V unknown Het
Cpne9 G A 6: 113,261,406 (GRCm39) V121M possibly damaging Het
Csmd2 T A 4: 128,377,249 (GRCm39) I2043N Het
Disc1 A G 8: 125,814,243 (GRCm39) T36A probably benign Het
Disp2 T C 2: 118,621,391 (GRCm39) Y708H probably damaging Het
Dnah3 A G 7: 119,670,793 (GRCm39) V635A probably benign Het
Dnah3 A T 7: 119,570,438 (GRCm39) probably null Het
Dync1li1 A G 9: 114,538,345 (GRCm39) H234R possibly damaging Het
Egfr T C 11: 16,839,966 (GRCm39) V660A possibly damaging Het
Epb42 T C 2: 120,858,200 (GRCm39) R253G possibly damaging Het
Fat2 T A 11: 55,202,247 (GRCm39) T276S probably benign Het
Fcho2 A G 13: 98,901,011 (GRCm39) probably null Het
Ginm1 A T 10: 7,655,119 (GRCm39) I41N probably damaging Het
Gm4744 A G 6: 40,927,367 (GRCm39) probably benign Het
Gm49368 C T 7: 127,711,398 (GRCm39) R701C probably damaging Het
Gpr37 T A 6: 25,688,207 (GRCm39) I297F probably benign Het
Gprc5a T A 6: 135,056,342 (GRCm39) I263N possibly damaging Het
Gys2 A T 6: 142,400,177 (GRCm39) S345T probably benign Het
Hk2 T C 6: 82,719,896 (GRCm39) M255V possibly damaging Het
Ibtk A C 9: 85,579,290 (GRCm39) S1202A possibly damaging Het
Il23r T G 6: 67,400,965 (GRCm39) D455A probably benign Het
Irs2 T A 8: 11,056,522 (GRCm39) K637* probably null Het
Jak2 T C 19: 29,260,946 (GRCm39) V314A probably benign Het
Mei1 C T 15: 81,966,824 (GRCm39) probably benign Het
Mill1 T C 7: 17,996,391 (GRCm39) M69T probably benign Het
Mms22l T C 4: 24,598,884 (GRCm39) probably null Het
Mup8 C A 4: 60,220,332 (GRCm39) Q133H probably benign Het
Mup8 T A 4: 60,220,333 (GRCm39) Q133L probably benign Het
Mycbp2 A T 14: 103,429,055 (GRCm39) Y2374N probably damaging Het
Nbeal1 A T 1: 60,296,609 (GRCm39) K1166N probably damaging Het
Nlrc4 T A 17: 74,755,191 (GRCm39) R8S probably benign Het
Nrcam C T 12: 44,596,681 (GRCm39) Q25* probably null Het
Nudt16 A C 9: 105,008,760 (GRCm39) M47R probably damaging Het
Nup62 T C 7: 44,478,419 (GRCm39) S145P probably benign Het
Or10d1 A G 9: 39,483,761 (GRCm39) W265R probably benign Het
Or4c117 T C 2: 88,955,333 (GRCm39) I247M possibly damaging Het
Osbpl1a A T 18: 13,066,657 (GRCm39) V34D probably benign Het
Otogl T A 10: 107,712,782 (GRCm39) N521Y probably damaging Het
Pcdhb14 T A 18: 37,582,887 (GRCm39) D664E possibly damaging Het
Pex5l T C 3: 33,136,300 (GRCm39) probably benign Het
Pkhd1 A G 1: 20,632,639 (GRCm39) L592P probably damaging Het
Plxdc2 A G 2: 16,734,187 (GRCm39) H480R probably benign Het
Rnf216 T A 5: 143,065,991 (GRCm39) K532N probably damaging Het
Schip1 C A 3: 68,525,028 (GRCm39) Q358K probably damaging Het
Sdc2 A T 15: 33,028,233 (GRCm39) E117V possibly damaging Het
Septin11 A T 5: 93,319,323 (GRCm39) probably null Het
Shprh A T 10: 11,037,924 (GRCm39) E420V probably benign Het
Ska1 T A 18: 74,330,044 (GRCm39) H232L probably benign Het
Slc36a4 A G 9: 15,630,956 (GRCm39) N25S possibly damaging Het
Slitrk3 G A 3: 72,958,172 (GRCm39) T200M probably damaging Het
Smad2 C T 18: 76,421,084 (GRCm39) H138Y probably benign Het
Snx21 T C 2: 164,628,085 (GRCm39) S34P probably damaging Het
Sos2 A G 12: 69,695,359 (GRCm39) V126A probably damaging Het
Srcap C T 7: 127,129,966 (GRCm39) T596I probably damaging Het
Stk31 T G 6: 49,383,877 (GRCm39) probably null Het
Stox1 T C 10: 62,499,743 (GRCm39) D939G probably damaging Het
Syne2 G T 12: 76,108,553 (GRCm39) C979F possibly damaging Het
Tanc2 C A 11: 105,667,684 (GRCm39) N88K possibly damaging Het
Tll2 A T 19: 41,084,447 (GRCm39) V677E probably damaging Het
Ttn T C 2: 76,748,834 (GRCm39) T4072A probably benign Het
Unc13b CAGAGC CAGAGCGAGAGC 4: 43,177,341 (GRCm39) probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 (GRCm39) probably benign Het
Unc13b AGAGCC AGAGCCCGAGCC 4: 43,177,330 (GRCm39) probably benign Het
Vmn2r43 A T 7: 8,258,253 (GRCm39) F320Y possibly damaging Het
Zscan4f G T 7: 11,135,205 (GRCm39) G204* probably null Het
Other mutations in Cmya5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Cmya5 APN 13 93,229,628 (GRCm39) missense probably benign 0.13
IGL00516:Cmya5 APN 13 93,234,675 (GRCm39) missense possibly damaging 0.73
IGL00654:Cmya5 APN 13 93,230,669 (GRCm39) missense probably benign 0.00
IGL00948:Cmya5 APN 13 93,227,544 (GRCm39) missense probably benign
IGL00966:Cmya5 APN 13 93,234,414 (GRCm39) missense probably benign 0.33
IGL00988:Cmya5 APN 13 93,234,441 (GRCm39) missense possibly damaging 0.96
IGL01106:Cmya5 APN 13 93,221,120 (GRCm39) missense probably damaging 1.00
IGL01331:Cmya5 APN 13 93,233,454 (GRCm39) missense possibly damaging 0.53
IGL01392:Cmya5 APN 13 93,225,714 (GRCm39) missense probably damaging 0.99
IGL01508:Cmya5 APN 13 93,230,535 (GRCm39) missense probably benign
IGL01679:Cmya5 APN 13 93,201,828 (GRCm39) missense probably damaging 1.00
IGL01749:Cmya5 APN 13 93,225,807 (GRCm39) missense probably benign 0.00
IGL01861:Cmya5 APN 13 93,226,256 (GRCm39) missense probably damaging 1.00
IGL02021:Cmya5 APN 13 93,231,057 (GRCm39) missense probably benign 0.00
IGL02034:Cmya5 APN 13 93,221,043 (GRCm39) splice site probably benign
IGL02103:Cmya5 APN 13 93,228,635 (GRCm39) missense probably benign 0.05
IGL02174:Cmya5 APN 13 93,185,415 (GRCm39) missense possibly damaging 0.76
IGL02176:Cmya5 APN 13 93,226,658 (GRCm39) missense probably damaging 1.00
IGL02210:Cmya5 APN 13 93,229,242 (GRCm39) missense probably benign 0.14
IGL02229:Cmya5 APN 13 93,229,194 (GRCm39) missense possibly damaging 0.54
IGL02306:Cmya5 APN 13 93,234,527 (GRCm39) missense probably damaging 1.00
IGL02311:Cmya5 APN 13 93,227,163 (GRCm39) missense probably benign 0.40
IGL02409:Cmya5 APN 13 93,226,706 (GRCm39) missense probably damaging 0.96
IGL02561:Cmya5 APN 13 93,228,366 (GRCm39) missense probably benign 0.00
IGL02676:Cmya5 APN 13 93,229,361 (GRCm39) missense probably damaging 1.00
IGL02683:Cmya5 APN 13 93,227,505 (GRCm39) nonsense probably null
IGL02685:Cmya5 APN 13 93,227,505 (GRCm39) nonsense probably null
IGL02686:Cmya5 APN 13 93,227,505 (GRCm39) nonsense probably null
IGL02724:Cmya5 APN 13 93,233,163 (GRCm39) missense probably benign
IGL02727:Cmya5 APN 13 93,234,753 (GRCm39) missense possibly damaging 0.73
IGL02965:Cmya5 APN 13 93,229,065 (GRCm39) missense probably benign 0.41
IGL03079:Cmya5 APN 13 93,234,209 (GRCm39) missense possibly damaging 0.85
IGL03144:Cmya5 APN 13 93,227,376 (GRCm39) missense probably damaging 1.00
IGL03253:Cmya5 APN 13 93,227,778 (GRCm39) nonsense probably null
IGL03336:Cmya5 APN 13 93,230,013 (GRCm39) missense possibly damaging 0.84
IGL03138:Cmya5 UTSW 13 93,201,850 (GRCm39) missense probably damaging 1.00
P0023:Cmya5 UTSW 13 93,225,854 (GRCm39) missense probably benign 0.22
P4748:Cmya5 UTSW 13 93,210,983 (GRCm39) splice site probably benign
R0123:Cmya5 UTSW 13 93,232,412 (GRCm39) missense possibly damaging 0.84
R0206:Cmya5 UTSW 13 93,232,065 (GRCm39) missense probably damaging 0.98
R0206:Cmya5 UTSW 13 93,232,065 (GRCm39) missense probably damaging 0.98
R0242:Cmya5 UTSW 13 93,232,108 (GRCm39) missense probably benign
R0242:Cmya5 UTSW 13 93,232,108 (GRCm39) missense probably benign
R0331:Cmya5 UTSW 13 93,280,911 (GRCm39) missense possibly damaging 0.53
R0363:Cmya5 UTSW 13 93,231,377 (GRCm39) missense possibly damaging 0.77
R0382:Cmya5 UTSW 13 93,229,256 (GRCm39) missense probably benign 0.06
R0416:Cmya5 UTSW 13 93,226,364 (GRCm39) missense probably benign 0.05
R0446:Cmya5 UTSW 13 93,230,164 (GRCm39) missense probably benign
R0457:Cmya5 UTSW 13 93,232,095 (GRCm39) missense possibly damaging 0.84
R0673:Cmya5 UTSW 13 93,226,505 (GRCm39) missense probably damaging 1.00
R0674:Cmya5 UTSW 13 93,229,299 (GRCm39) missense probably damaging 1.00
R0692:Cmya5 UTSW 13 93,230,357 (GRCm39) nonsense probably null
R0698:Cmya5 UTSW 13 93,232,065 (GRCm39) missense probably damaging 0.98
R1227:Cmya5 UTSW 13 93,230,954 (GRCm39) missense probably damaging 0.99
R1272:Cmya5 UTSW 13 93,231,620 (GRCm39) missense possibly damaging 0.79
R1335:Cmya5 UTSW 13 93,178,043 (GRCm39) missense possibly damaging 0.65
R1353:Cmya5 UTSW 13 93,178,033 (GRCm39) missense probably damaging 1.00
R1354:Cmya5 UTSW 13 93,228,566 (GRCm39) missense possibly damaging 0.46
R1458:Cmya5 UTSW 13 93,201,835 (GRCm39) missense probably benign 0.44
R1572:Cmya5 UTSW 13 93,230,777 (GRCm39) missense possibly damaging 0.61
R1698:Cmya5 UTSW 13 93,200,027 (GRCm39) missense probably benign 0.27
R1735:Cmya5 UTSW 13 93,226,297 (GRCm39) missense probably benign 0.11
R1743:Cmya5 UTSW 13 93,233,825 (GRCm39) missense probably benign 0.33
R1750:Cmya5 UTSW 13 93,232,171 (GRCm39) missense probably benign
R1827:Cmya5 UTSW 13 93,210,956 (GRCm39) missense possibly damaging 0.80
R2068:Cmya5 UTSW 13 93,227,032 (GRCm39) missense possibly damaging 0.93
R2088:Cmya5 UTSW 13 93,229,320 (GRCm39) missense probably damaging 1.00
R2132:Cmya5 UTSW 13 93,205,891 (GRCm39) missense probably damaging 1.00
R2216:Cmya5 UTSW 13 93,230,003 (GRCm39) missense probably damaging 1.00
R2363:Cmya5 UTSW 13 93,230,210 (GRCm39) missense probably benign 0.15
R2497:Cmya5 UTSW 13 93,234,513 (GRCm39) missense possibly damaging 0.53
R2509:Cmya5 UTSW 13 93,230,066 (GRCm39) missense probably benign 0.41
R2917:Cmya5 UTSW 13 93,227,572 (GRCm39) nonsense probably null
R2944:Cmya5 UTSW 13 93,229,350 (GRCm39) nonsense probably null
R3039:Cmya5 UTSW 13 93,228,758 (GRCm39) missense probably benign 0.12
R3078:Cmya5 UTSW 13 93,185,435 (GRCm39) missense probably damaging 0.99
R3708:Cmya5 UTSW 13 93,231,874 (GRCm39) nonsense probably null
R3717:Cmya5 UTSW 13 93,228,995 (GRCm39) missense probably benign 0.12
R3768:Cmya5 UTSW 13 93,233,201 (GRCm39) missense possibly damaging 0.73
R3769:Cmya5 UTSW 13 93,233,201 (GRCm39) missense possibly damaging 0.73
R3840:Cmya5 UTSW 13 93,231,140 (GRCm39) missense probably damaging 0.96
R3841:Cmya5 UTSW 13 93,231,140 (GRCm39) missense probably damaging 0.96
R3882:Cmya5 UTSW 13 93,227,727 (GRCm39) missense probably benign 0.07
R3888:Cmya5 UTSW 13 93,230,164 (GRCm39) missense probably benign
R3897:Cmya5 UTSW 13 93,233,189 (GRCm39) missense possibly damaging 0.72
R3952:Cmya5 UTSW 13 93,225,707 (GRCm39) missense possibly damaging 0.89
R4366:Cmya5 UTSW 13 93,228,464 (GRCm39) missense probably benign 0.36
R4471:Cmya5 UTSW 13 93,228,833 (GRCm39) missense probably benign 0.01
R4493:Cmya5 UTSW 13 93,230,573 (GRCm39) missense probably benign
R4495:Cmya5 UTSW 13 93,230,573 (GRCm39) missense probably benign
R4544:Cmya5 UTSW 13 93,228,426 (GRCm39) nonsense probably null
R4545:Cmya5 UTSW 13 93,228,426 (GRCm39) nonsense probably null
R4624:Cmya5 UTSW 13 93,200,059 (GRCm39) missense probably damaging 1.00
R4648:Cmya5 UTSW 13 93,230,336 (GRCm39) missense possibly damaging 0.84
R4824:Cmya5 UTSW 13 93,230,082 (GRCm39) missense probably benign 0.04
R4965:Cmya5 UTSW 13 93,232,295 (GRCm39) missense possibly damaging 0.84
R4967:Cmya5 UTSW 13 93,227,093 (GRCm39) missense probably damaging 1.00
R5101:Cmya5 UTSW 13 93,228,111 (GRCm39) missense possibly damaging 0.61
R5133:Cmya5 UTSW 13 93,229,880 (GRCm39) missense possibly damaging 0.79
R5139:Cmya5 UTSW 13 93,232,569 (GRCm39) missense probably benign 0.00
R5220:Cmya5 UTSW 13 93,228,804 (GRCm39) missense probably damaging 0.99
R5332:Cmya5 UTSW 13 93,232,703 (GRCm39) missense probably damaging 0.96
R5337:Cmya5 UTSW 13 93,219,781 (GRCm39) missense probably benign 0.28
R5356:Cmya5 UTSW 13 93,199,993 (GRCm39) missense probably damaging 1.00
R5401:Cmya5 UTSW 13 93,228,476 (GRCm39) missense probably damaging 1.00
R5438:Cmya5 UTSW 13 93,231,707 (GRCm39) missense possibly damaging 0.89
R5604:Cmya5 UTSW 13 93,229,271 (GRCm39) missense probably benign 0.15
R5628:Cmya5 UTSW 13 93,226,218 (GRCm39) missense probably damaging 1.00
R5666:Cmya5 UTSW 13 93,182,457 (GRCm39) missense possibly damaging 0.75
R5687:Cmya5 UTSW 13 93,234,684 (GRCm39) missense possibly damaging 0.53
R5695:Cmya5 UTSW 13 93,182,374 (GRCm39) critical splice donor site probably null
R5806:Cmya5 UTSW 13 93,230,445 (GRCm39) missense possibly damaging 0.84
R5820:Cmya5 UTSW 13 93,229,288 (GRCm39) missense probably benign 0.04
R5872:Cmya5 UTSW 13 93,233,943 (GRCm39) missense probably benign 0.01
R5875:Cmya5 UTSW 13 93,231,692 (GRCm39) missense probably benign 0.13
R5896:Cmya5 UTSW 13 93,182,373 (GRCm39) critical splice donor site probably null
R5910:Cmya5 UTSW 13 93,229,151 (GRCm39) missense probably damaging 0.98
R5969:Cmya5 UTSW 13 93,226,052 (GRCm39) missense possibly damaging 0.78
R6064:Cmya5 UTSW 13 93,226,157 (GRCm39) missense probably damaging 1.00
R6081:Cmya5 UTSW 13 93,281,021 (GRCm39) unclassified probably benign
R6102:Cmya5 UTSW 13 93,230,739 (GRCm39) missense probably benign
R6117:Cmya5 UTSW 13 93,231,674 (GRCm39) missense probably damaging 0.98
R6188:Cmya5 UTSW 13 93,233,784 (GRCm39) missense possibly damaging 0.73
R6188:Cmya5 UTSW 13 93,229,952 (GRCm39) missense possibly damaging 0.61
R6219:Cmya5 UTSW 13 93,230,951 (GRCm39) missense probably damaging 1.00
R6229:Cmya5 UTSW 13 93,229,814 (GRCm39) missense probably benign 0.41
R6346:Cmya5 UTSW 13 93,228,698 (GRCm39) missense probably damaging 1.00
R6431:Cmya5 UTSW 13 93,210,972 (GRCm39) missense possibly damaging 0.60
R6436:Cmya5 UTSW 13 93,225,723 (GRCm39) missense probably damaging 0.98
R6598:Cmya5 UTSW 13 93,226,316 (GRCm39) missense probably benign 0.05
R6649:Cmya5 UTSW 13 93,234,533 (GRCm39) missense possibly damaging 0.91
R6652:Cmya5 UTSW 13 93,229,547 (GRCm39) missense probably damaging 0.99
R6652:Cmya5 UTSW 13 93,229,403 (GRCm39) missense probably benign 0.04
R6669:Cmya5 UTSW 13 93,229,767 (GRCm39) missense probably benign 0.03
R6881:Cmya5 UTSW 13 93,226,800 (GRCm39) missense probably damaging 1.00
R6909:Cmya5 UTSW 13 93,227,760 (GRCm39) missense probably benign 0.04
R6933:Cmya5 UTSW 13 93,231,644 (GRCm39) missense probably benign 0.03
R7021:Cmya5 UTSW 13 93,230,063 (GRCm39) missense possibly damaging 0.62
R7022:Cmya5 UTSW 13 93,205,786 (GRCm39) critical splice donor site probably null
R7068:Cmya5 UTSW 13 93,229,205 (GRCm39) missense possibly damaging 0.59
R7087:Cmya5 UTSW 13 93,227,483 (GRCm39) missense probably benign 0.00
R7088:Cmya5 UTSW 13 93,228,372 (GRCm39) missense possibly damaging 0.95
R7126:Cmya5 UTSW 13 93,226,448 (GRCm39) missense probably benign 0.41
R7177:Cmya5 UTSW 13 93,231,836 (GRCm39) missense probably benign 0.00
R7188:Cmya5 UTSW 13 93,182,546 (GRCm39) missense probably damaging 1.00
R7217:Cmya5 UTSW 13 93,226,938 (GRCm39) missense probably damaging 1.00
R7278:Cmya5 UTSW 13 93,232,208 (GRCm39) missense probably damaging 0.96
R7293:Cmya5 UTSW 13 93,229,305 (GRCm39) missense possibly damaging 0.90
R7332:Cmya5 UTSW 13 93,229,061 (GRCm39) missense possibly damaging 0.60
R7375:Cmya5 UTSW 13 93,228,169 (GRCm39) missense probably damaging 0.97
R7386:Cmya5 UTSW 13 93,205,831 (GRCm39) missense probably damaging 1.00
R7489:Cmya5 UTSW 13 93,228,346 (GRCm39) missense possibly damaging 0.87
R7529:Cmya5 UTSW 13 93,233,942 (GRCm39) missense probably benign 0.02
R7552:Cmya5 UTSW 13 93,205,820 (GRCm39) missense probably benign 0.41
R7624:Cmya5 UTSW 13 93,226,865 (GRCm39) missense possibly damaging 0.79
R7637:Cmya5 UTSW 13 93,219,720 (GRCm39) missense possibly damaging 0.87
R7673:Cmya5 UTSW 13 93,230,629 (GRCm39) missense probably benign 0.13
R7753:Cmya5 UTSW 13 93,234,680 (GRCm39) missense probably benign 0.18
R7806:Cmya5 UTSW 13 93,230,770 (GRCm39) missense probably benign 0.00
R7825:Cmya5 UTSW 13 93,234,136 (GRCm39) missense possibly damaging 0.53
R7878:Cmya5 UTSW 13 93,226,265 (GRCm39) missense probably damaging 0.98
R7892:Cmya5 UTSW 13 93,232,865 (GRCm39) missense probably damaging 0.96
R7952:Cmya5 UTSW 13 93,233,512 (GRCm39) small deletion probably benign
R8127:Cmya5 UTSW 13 93,231,122 (GRCm39) missense probably damaging 0.99
R8256:Cmya5 UTSW 13 93,229,986 (GRCm39) missense possibly damaging 0.62
R8339:Cmya5 UTSW 13 93,228,142 (GRCm39) nonsense probably null
R8446:Cmya5 UTSW 13 93,230,336 (GRCm39) missense possibly damaging 0.84
R8553:Cmya5 UTSW 13 93,230,304 (GRCm39) missense probably benign 0.00
R8686:Cmya5 UTSW 13 93,231,888 (GRCm39) missense possibly damaging 0.91
R8748:Cmya5 UTSW 13 93,226,229 (GRCm39) missense probably damaging 1.00
R8783:Cmya5 UTSW 13 93,225,888 (GRCm39) missense possibly damaging 0.58
R8803:Cmya5 UTSW 13 93,177,991 (GRCm39) missense probably damaging 1.00
R8810:Cmya5 UTSW 13 93,200,048 (GRCm39) missense possibly damaging 0.47
R8937:Cmya5 UTSW 13 93,232,840 (GRCm39) missense probably benign 0.01
R8985:Cmya5 UTSW 13 93,233,664 (GRCm39) missense possibly damaging 0.73
R9017:Cmya5 UTSW 13 93,228,572 (GRCm39) missense probably benign 0.03
R9087:Cmya5 UTSW 13 93,233,711 (GRCm39) missense possibly damaging 0.72
R9133:Cmya5 UTSW 13 93,234,108 (GRCm39) missense possibly damaging 0.73
R9156:Cmya5 UTSW 13 93,233,878 (GRCm39) missense unknown
R9209:Cmya5 UTSW 13 93,226,866 (GRCm39) missense probably benign 0.45
R9222:Cmya5 UTSW 13 93,230,579 (GRCm39) missense probably benign 0.00
R9229:Cmya5 UTSW 13 93,232,176 (GRCm39) missense possibly damaging 0.92
R9382:Cmya5 UTSW 13 93,229,884 (GRCm39) missense probably benign
R9385:Cmya5 UTSW 13 93,230,880 (GRCm39) missense probably damaging 0.99
R9418:Cmya5 UTSW 13 93,226,209 (GRCm39) missense probably benign 0.22
R9452:Cmya5 UTSW 13 93,232,394 (GRCm39) missense probably benign
R9492:Cmya5 UTSW 13 93,177,822 (GRCm39) makesense probably null
R9600:Cmya5 UTSW 13 93,226,604 (GRCm39) missense probably damaging 1.00
R9712:Cmya5 UTSW 13 93,201,881 (GRCm39) critical splice acceptor site probably null
R9742:Cmya5 UTSW 13 93,231,935 (GRCm39) missense possibly damaging 0.89
RF020:Cmya5 UTSW 13 93,205,799 (GRCm39) missense possibly damaging 0.56
X0028:Cmya5 UTSW 13 93,233,195 (GRCm39) missense possibly damaging 0.53
Z1088:Cmya5 UTSW 13 93,200,087 (GRCm39) missense probably benign
Z1176:Cmya5 UTSW 13 93,233,298 (GRCm39) missense unknown
Z1176:Cmya5 UTSW 13 93,200,087 (GRCm39) missense probably benign
Z1177:Cmya5 UTSW 13 93,200,087 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CATCTTGTGATTCCAGAGAATTCC -3'
(R):5'- TTCACCCCACATTTGAGGTG -3'

Sequencing Primer
(F):5'- ACGCTTGGACTTCTGAG -3'
(R):5'- AGGTGGATGTGAGTACTGACTTC -3'
Posted On 2019-11-26