Incidental Mutation 'R7757:2410089E03Rik'
ID 597641
Institutional Source Beutler Lab
Gene Symbol 2410089E03Rik
Ensembl Gene ENSMUSG00000039801
Gene Name RIKEN cDNA 2410089E03 gene
Synonyms b2b012Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7757 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 8169106-8271158 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 8252227 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 2850 (E2850V)
Ref Sequence ENSEMBL: ENSMUSP00000106247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110617]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000110617
AA Change: E2850V
SMART Domains Protein: ENSMUSP00000106247
Gene: ENSMUSG00000039801
AA Change: E2850V

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
low complexity region 868 883 N/A INTRINSIC
low complexity region 949 962 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1449 1464 N/A INTRINSIC
low complexity region 1827 1838 N/A INTRINSIC
low complexity region 1919 1930 N/A INTRINSIC
low complexity region 2130 2145 N/A INTRINSIC
coiled coil region 2750 2782 N/A INTRINSIC
low complexity region 2838 2850 N/A INTRINSIC
Pfam:Joubert 2894 3207 1.9e-136 PFAM
Meta Mutation Damage Score 0.0643 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes exhibit double outlet right ventricle {SDD}, pulmonary atresia/hypolastic pulmonary artery, atrioventricular septal defect, and right aortic arch. Non-cardiovascular defects include cleft palate, polydactyly, transparent chest wall (sternal bone hypoplasia) and hypoplastic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,189,413 M1179I probably benign Het
6430550D23Rik T C 2: 156,003,431 T18A possibly damaging Het
Acox2 T C 14: 8,230,166 N659S probably damaging Het
Agk T C 6: 40,376,278 V192A possibly damaging Het
Ap3b1 T A 13: 94,528,158 probably null Het
Bche T A 3: 73,701,121 D324V probably damaging Het
Bsn A G 9: 108,114,740 I1271T possibly damaging Het
Capn12 T C 7: 28,882,821 L120P probably damaging Het
Cep290 T A 10: 100,563,434 S2273T probably benign Het
Ckap4 T C 10: 84,528,467 E244G probably damaging Het
Clcn7 T C 17: 25,156,822 Y545H probably damaging Het
Cmya5 T A 13: 93,098,272 T103S possibly damaging Het
Cpne9 G A 6: 113,284,445 V121M possibly damaging Het
Csmd2 T A 4: 128,483,456 I2043N Het
Disc1 A G 8: 125,087,504 T36A probably benign Het
Disp2 T C 2: 118,790,910 Y708H probably damaging Het
Dnah3 A G 7: 120,071,570 V635A probably benign Het
Dnah3 A T 7: 119,971,215 probably null Het
Dync1li1 A G 9: 114,709,277 H234R possibly damaging Het
Egfr T C 11: 16,889,966 V660A possibly damaging Het
Epb42 T C 2: 121,027,719 R253G possibly damaging Het
Fat2 T A 11: 55,311,421 T276S probably benign Het
Fcho2 A G 13: 98,764,503 probably null Het
Ginm1 A T 10: 7,779,355 I41N probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm49368 C T 7: 128,112,226 R701C probably damaging Het
Gpr37 T A 6: 25,688,208 I297F probably benign Het
Gprc5a T A 6: 135,079,344 I263N possibly damaging Het
Gys2 A T 6: 142,454,451 S345T probably benign Het
Hk2 T C 6: 82,742,915 M255V possibly damaging Het
Ibtk A C 9: 85,697,237 S1202A possibly damaging Het
Il23r T G 6: 67,423,981 D455A probably benign Het
Irs2 T A 8: 11,006,522 K637* probably null Het
Jak2 T C 19: 29,283,546 V314A probably benign Het
Mei1 C T 15: 82,082,623 probably benign Het
Mill1 T C 7: 18,262,466 M69T probably benign Het
Mms22l T C 4: 24,598,884 probably null Het
Mup8 C A 4: 60,220,332 Q133H probably benign Het
Mup8 T A 4: 60,220,333 Q133L probably benign Het
Mycbp2 A T 14: 103,191,619 Y2374N probably damaging Het
Nbeal1 A T 1: 60,257,450 K1166N probably damaging Het
Nlrc4 T A 17: 74,448,196 R8S probably benign Het
Nrcam C T 12: 44,549,898 Q25* probably null Het
Nudt16 A C 9: 105,131,561 M47R probably damaging Het
Nup62 T C 7: 44,828,995 S145P probably benign Het
Olfr1222 T C 2: 89,124,989 I247M possibly damaging Het
Olfr959 A G 9: 39,572,465 W265R probably benign Het
Osbpl1a A T 18: 12,933,600 V34D probably benign Het
Otogl T A 10: 107,876,921 N521Y probably damaging Het
Pcdhb14 T A 18: 37,449,834 D664E possibly damaging Het
Pex5l T C 3: 33,082,151 probably benign Het
Pkhd1 A G 1: 20,562,415 L592P probably damaging Het
Plxdc2 A G 2: 16,729,376 H480R probably benign Het
Rnf216 T A 5: 143,080,236 K532N probably damaging Het
Schip1 C A 3: 68,617,695 Q358K probably damaging Het
Sdc2 A T 15: 33,028,087 E117V possibly damaging Het
Sept11 A T 5: 93,171,464 probably null Het
Shprh A T 10: 11,162,180 E420V probably benign Het
Ska1 T A 18: 74,196,973 H232L probably benign Het
Slc36a4 A G 9: 15,719,660 N25S possibly damaging Het
Slitrk3 G A 3: 73,050,839 T200M probably damaging Het
Smad2 C T 18: 76,288,013 H138Y probably benign Het
Snx21 T C 2: 164,786,165 S34P probably damaging Het
Sos2 A G 12: 69,648,585 V126A probably damaging Het
Srcap C T 7: 127,530,794 T596I probably damaging Het
Stk31 T G 6: 49,406,943 probably null Het
Stox1 T C 10: 62,663,964 D939G probably damaging Het
Syne2 G T 12: 76,061,779 C979F possibly damaging Het
Tanc2 C A 11: 105,776,858 N88K possibly damaging Het
Tll2 A T 19: 41,096,008 V677E probably damaging Het
Ttn T C 2: 76,918,490 T4072A probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Unc13b AGAGCC AGAGCCCGAGCC 4: 43,177,330 probably benign Het
Unc13b CAGAGC CAGAGCGAGAGC 4: 43,177,341 probably benign Het
Vmn2r43 A T 7: 8,255,254 F320Y possibly damaging Het
Zscan4f G T 7: 11,401,278 G204* probably null Het
Other mutations in 2410089E03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:2410089E03Rik APN 15 8264447 splice site probably benign
IGL00766:2410089E03Rik APN 15 8252164 missense unknown
IGL01483:2410089E03Rik APN 15 8187107 missense probably damaging 0.98
IGL01520:2410089E03Rik APN 15 8221911 missense probably damaging 0.96
IGL01578:2410089E03Rik APN 15 8270710 missense unknown
IGL01701:2410089E03Rik APN 15 8203257 splice site probably benign
IGL01892:2410089E03Rik APN 15 8242265 splice site probably benign
IGL01895:2410089E03Rik APN 15 8229107 missense possibly damaging 0.63
IGL01922:2410089E03Rik APN 15 8270821 missense unknown
IGL01978:2410089E03Rik APN 15 8219382 missense probably damaging 0.98
IGL02031:2410089E03Rik APN 15 8179769 missense probably damaging 0.99
IGL02318:2410089E03Rik APN 15 8175025 missense probably damaging 0.98
IGL02321:2410089E03Rik APN 15 8216572 missense probably benign 0.04
IGL02363:2410089E03Rik APN 15 8218437 missense possibly damaging 0.68
IGL02404:2410089E03Rik APN 15 8187284 missense possibly damaging 0.48
IGL02535:2410089E03Rik APN 15 8174838 missense probably damaging 1.00
IGL02732:2410089E03Rik APN 15 8179891 missense probably benign 0.03
IGL02895:2410089E03Rik APN 15 8232107 splice site probably benign
IGL02903:2410089E03Rik APN 15 8269778 missense unknown
IGL02903:2410089E03Rik APN 15 8269779 missense unknown
IGL02979:2410089E03Rik APN 15 8218554 missense possibly damaging 0.82
IGL03077:2410089E03Rik APN 15 8212795 splice site probably benign
IGL03196:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
IGL03344:2410089E03Rik APN 15 8187458 missense possibly damaging 0.63
IGL03368:2410089E03Rik APN 15 8222373 missense probably benign 0.06
IGL03403:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
agnes UTSW 15 8246938 nonsense probably null
dei UTSW 15 8186165 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0101:2410089E03Rik UTSW 15 8220960 missense probably benign 0.00
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0165:2410089E03Rik UTSW 15 8216382 missense probably damaging 1.00
R0306:2410089E03Rik UTSW 15 8179889 missense probably damaging 1.00
R0433:2410089E03Rik UTSW 15 8216562 missense probably benign 0.00
R0491:2410089E03Rik UTSW 15 8182243 missense probably damaging 1.00
R0523:2410089E03Rik UTSW 15 8194386 missense probably damaging 1.00
R0571:2410089E03Rik UTSW 15 8259793 missense unknown
R0679:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R0704:2410089E03Rik UTSW 15 8210083 missense possibly damaging 0.93
R0707:2410089E03Rik UTSW 15 8258321 missense unknown
R0715:2410089E03Rik UTSW 15 8223092 missense probably benign 0.14
R0762:2410089E03Rik UTSW 15 8218416 unclassified probably benign
R0830:2410089E03Rik UTSW 15 8247185 missense unknown
R0924:2410089E03Rik UTSW 15 8251070 splice site probably benign
R1071:2410089E03Rik UTSW 15 8218426 missense probably benign 0.20
R1184:2410089E03Rik UTSW 15 8216487 missense probably benign
R1224:2410089E03Rik UTSW 15 8178385 missense probably benign 0.06
R1416:2410089E03Rik UTSW 15 8246938 nonsense probably null
R1428:2410089E03Rik UTSW 15 8219369 missense possibly damaging 0.83
R1487:2410089E03Rik UTSW 15 8186231 missense probably damaging 1.00
R1641:2410089E03Rik UTSW 15 8228959 missense probably benign 0.41
R1652:2410089E03Rik UTSW 15 8201146 missense probably damaging 1.00
R1688:2410089E03Rik UTSW 15 8228609 missense probably benign 0.00
R1715:2410089E03Rik UTSW 15 8226900 splice site probably null
R1820:2410089E03Rik UTSW 15 8269645 missense unknown
R1863:2410089E03Rik UTSW 15 8228593 missense probably benign 0.00
R1940:2410089E03Rik UTSW 15 8233852 missense probably damaging 0.98
R1967:2410089E03Rik UTSW 15 8203420 missense probably benign 0.09
R2064:2410089E03Rik UTSW 15 8186165 missense probably damaging 1.00
R2076:2410089E03Rik UTSW 15 8219257 missense possibly damaging 0.93
R2163:2410089E03Rik UTSW 15 8203251 splice site probably null
R2208:2410089E03Rik UTSW 15 8194403 missense probably benign 0.33
R2504:2410089E03Rik UTSW 15 8219216 missense probably damaging 0.99
R2568:2410089E03Rik UTSW 15 8201269 missense possibly damaging 0.70
R2845:2410089E03Rik UTSW 15 8216380 missense probably damaging 1.00
R2913:2410089E03Rik UTSW 15 8270685 missense unknown
R3056:2410089E03Rik UTSW 15 8251007 missense unknown
R3706:2410089E03Rik UTSW 15 8259816 missense unknown
R3707:2410089E03Rik UTSW 15 8259816 missense unknown
R3870:2410089E03Rik UTSW 15 8218464 missense probably damaging 0.98
R3877:2410089E03Rik UTSW 15 8221943 missense probably benign
R3886:2410089E03Rik UTSW 15 8171805 missense probably damaging 0.98
R4057:2410089E03Rik UTSW 15 8219025 missense probably benign 0.08
R4090:2410089E03Rik UTSW 15 8212358 splice site probably null
R4362:2410089E03Rik UTSW 15 8270745 missense unknown
R4363:2410089E03Rik UTSW 15 8270745 missense unknown
R4445:2410089E03Rik UTSW 15 8252188 missense unknown
R4581:2410089E03Rik UTSW 15 8171798 missense possibly damaging 0.85
R4587:2410089E03Rik UTSW 15 8201152 missense possibly damaging 0.50
R4659:2410089E03Rik UTSW 15 8216276 intron probably benign
R4663:2410089E03Rik UTSW 15 8218455 missense probably benign 0.31
R4779:2410089E03Rik UTSW 15 8218838 missense probably benign 0.04
R4812:2410089E03Rik UTSW 15 8201123 splice site probably null
R4850:2410089E03Rik UTSW 15 8262938 missense unknown
R4896:2410089E03Rik UTSW 15 8221937 missense probably benign 0.00
R5273:2410089E03Rik UTSW 15 8244341 missense probably damaging 0.98
R5273:2410089E03Rik UTSW 15 8262938 missense unknown
R5303:2410089E03Rik UTSW 15 8260690 splice site probably null
R5307:2410089E03Rik UTSW 15 8260690 splice site probably null
R5308:2410089E03Rik UTSW 15 8260690 splice site probably null
R5373:2410089E03Rik UTSW 15 8270803 missense unknown
R5374:2410089E03Rik UTSW 15 8270803 missense unknown
R5386:2410089E03Rik UTSW 15 8194413 missense probably damaging 1.00
R5534:2410089E03Rik UTSW 15 8228835 missense probably benign 0.06
R5720:2410089E03Rik UTSW 15 8203687 missense probably benign 0.35
R5891:2410089E03Rik UTSW 15 8188589 missense probably benign 0.00
R5932:2410089E03Rik UTSW 15 8244595 splice site probably null
R6053:2410089E03Rik UTSW 15 8188461 missense probably benign 0.35
R6166:2410089E03Rik UTSW 15 8186560 missense probably benign 0.00
R6245:2410089E03Rik UTSW 15 8178418 missense probably benign 0.01
R6246:2410089E03Rik UTSW 15 8210014 missense probably damaging 1.00
R6541:2410089E03Rik UTSW 15 8219295 missense possibly damaging 0.48
R6622:2410089E03Rik UTSW 15 8244222 missense probably damaging 0.98
R6707:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R6729:2410089E03Rik UTSW 15 8188601 splice site probably null
R6805:2410089E03Rik UTSW 15 8244306 missense probably benign 0.07
R6806:2410089E03Rik UTSW 15 8186858 missense possibly damaging 0.55
R6813:2410089E03Rik UTSW 15 8229282 missense probably benign
R6830:2410089E03Rik UTSW 15 8176184 missense probably benign 0.04
R6845:2410089E03Rik UTSW 15 8221904 missense possibly damaging 0.84
R6894:2410089E03Rik UTSW 15 8187368 missense probably damaging 0.99
R6970:2410089E03Rik UTSW 15 8187548 missense probably benign 0.01
R6991:2410089E03Rik UTSW 15 8252206 missense unknown
R7003:2410089E03Rik UTSW 15 8228762 missense probably damaging 0.99
R7088:2410089E03Rik UTSW 15 8218947 missense probably benign 0.16
R7104:2410089E03Rik UTSW 15 8194444 missense possibly damaging 0.83
R7311:2410089E03Rik UTSW 15 8180915 missense probably damaging 1.00
R7374:2410089E03Rik UTSW 15 8247247 missense unknown
R7446:2410089E03Rik UTSW 15 8232080 missense probably damaging 0.98
R7539:2410089E03Rik UTSW 15 8201244 missense probably benign 0.19
R7543:2410089E03Rik UTSW 15 8225392 missense unknown
R7558:2410089E03Rik UTSW 15 8225367 missense unknown
R7629:2410089E03Rik UTSW 15 8227067 nonsense probably null
R7635:2410089E03Rik UTSW 15 8226920 missense probably benign 0.01
R7644:2410089E03Rik UTSW 15 8223127 missense probably benign 0.00
R7705:2410089E03Rik UTSW 15 8182252 missense probably damaging 1.00
R7752:2410089E03Rik UTSW 15 8269706 missense unknown
R7754:2410089E03Rik UTSW 15 8243826 missense possibly damaging 0.53
R7836:2410089E03Rik UTSW 15 8203757 missense probably damaging 0.97
R7875:2410089E03Rik UTSW 15 8209962 missense probably benign 0.18
R7901:2410089E03Rik UTSW 15 8269706 missense unknown
R7983:2410089E03Rik UTSW 15 8221815 missense probably benign 0.01
R8030:2410089E03Rik UTSW 15 8230303 missense probably damaging 1.00
R8088:2410089E03Rik UTSW 15 8186318 missense probably benign 0.00
R8231:2410089E03Rik UTSW 15 8219027 missense probably benign 0.16
R8443:2410089E03Rik UTSW 15 8201151 missense probably benign 0.03
R8480:2410089E03Rik UTSW 15 8187458 missense possibly damaging 0.63
R8693:2410089E03Rik UTSW 15 8229008 missense probably benign 0.15
R8785:2410089E03Rik UTSW 15 8174760 missense probably benign 0.39
R8791:2410089E03Rik UTSW 15 8187260 missense probably damaging 1.00
R8822:2410089E03Rik UTSW 15 8171778 missense probably damaging 1.00
R8831:2410089E03Rik UTSW 15 8182136 missense probably benign 0.09
R8932:2410089E03Rik UTSW 15 8194375 missense probably damaging 1.00
R8968:2410089E03Rik UTSW 15 8201281 missense possibly damaging 0.84
R8973:2410089E03Rik UTSW 15 8203793 missense probably damaging 1.00
R9036:2410089E03Rik UTSW 15 8223138 missense possibly damaging 0.63
R9134:2410089E03Rik UTSW 15 8199232 missense probably damaging 0.99
R9197:2410089E03Rik UTSW 15 8251052 missense unknown
R9259:2410089E03Rik UTSW 15 8203303 missense possibly damaging 0.82
R9269:2410089E03Rik UTSW 15 8219016 missense probably damaging 0.97
R9294:2410089E03Rik UTSW 15 8203327 missense probably benign 0.00
R9328:2410089E03Rik UTSW 15 8186208 missense probably damaging 1.00
R9563:2410089E03Rik UTSW 15 8187079 missense probably benign 0.20
R9680:2410089E03Rik UTSW 15 8202301 missense possibly damaging 0.68
R9721:2410089E03Rik UTSW 15 8225409 missense unknown
R9779:2410089E03Rik UTSW 15 8201302 missense possibly damaging 0.93
R9780:2410089E03Rik UTSW 15 8228639 missense probably benign 0.00
U24488:2410089E03Rik UTSW 15 8182210 missense probably damaging 1.00
X0023:2410089E03Rik UTSW 15 8247031 missense unknown
Z1177:2410089E03Rik UTSW 15 8174972 missense probably damaging 1.00
Z1177:2410089E03Rik UTSW 15 8209989 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAACTGCTGTCTGTTCGCTG -3'
(R):5'- AACTCACAACCCTTTATACCTGTGC -3'

Sequencing Primer
(F):5'- GCTAACTATCTTCCGTAGTTAAAACG -3'
(R):5'- TATACCTGTGCCCCTCCCAGG -3'
Posted On 2019-11-26