Incidental Mutation 'R7757:Pcdhb14'
ID 597647
Institutional Source Beutler Lab
Gene Symbol Pcdhb14
Ensembl Gene ENSMUSG00000044043
Gene Name protocadherin beta 14
Synonyms PcdhbN, 2210006M07Rik, Pcdhb17
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R7757 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 37447656-37456350 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37449834 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 664 (D664E)
Ref Sequence ENSEMBL: ENSMUSP00000054111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052387] [ENSMUST00000056915] [ENSMUST00000115661] [ENSMUST00000194544]
AlphaFold Q6PB90
PDB Structure Solution structure of mouse protocadherin beta 14 (26-137) [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052387
AA Change: D664E

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000054111
Gene: ENSMUSG00000044043
AA Change: D664E

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 1.4e-35 PFAM
CA 155 240 1.53e-20 SMART
CA 264 345 3.52e-29 SMART
CA 368 449 2.24e-22 SMART
CA 473 559 2.38e-26 SMART
CA 589 670 4.12e-12 SMART
Pfam:Cadherin_C_2 685 768 4.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056915
SMART Domains Protein: ENSMUSP00000061087
Gene: ENSMUSG00000047307

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 58 130 5.5e-1 SMART
CA 154 239 8.55e-19 SMART
CA 263 343 3.36e-26 SMART
CA 366 447 2.24e-22 SMART
CA 471 557 1.08e-24 SMART
CA 587 668 1.25e-11 SMART
Pfam:Cadherin_C_2 685 768 2.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A T 15: 8,252,227 E2850V unknown Het
2700049A03Rik G A 12: 71,189,413 M1179I probably benign Het
6430550D23Rik T C 2: 156,003,431 T18A possibly damaging Het
Acox2 T C 14: 8,230,166 N659S probably damaging Het
Agk T C 6: 40,376,278 V192A possibly damaging Het
Ap3b1 T A 13: 94,528,158 probably null Het
Bche T A 3: 73,701,121 D324V probably damaging Het
Bsn A G 9: 108,114,740 I1271T possibly damaging Het
Capn12 T C 7: 28,882,821 L120P probably damaging Het
Cep290 T A 10: 100,563,434 S2273T probably benign Het
Ckap4 T C 10: 84,528,467 E244G probably damaging Het
Clcn7 T C 17: 25,156,822 Y545H probably damaging Het
Cmya5 T A 13: 93,098,272 T103S possibly damaging Het
Cpne9 G A 6: 113,284,445 V121M possibly damaging Het
Csmd2 T A 4: 128,483,456 I2043N Het
Disc1 A G 8: 125,087,504 T36A probably benign Het
Disp2 T C 2: 118,790,910 Y708H probably damaging Het
Dnah3 A T 7: 119,971,215 probably null Het
Dnah3 A G 7: 120,071,570 V635A probably benign Het
Dync1li1 A G 9: 114,709,277 H234R possibly damaging Het
Egfr T C 11: 16,889,966 V660A possibly damaging Het
Epb42 T C 2: 121,027,719 R253G possibly damaging Het
Fat2 T A 11: 55,311,421 T276S probably benign Het
Fcho2 A G 13: 98,764,503 probably null Het
Ginm1 A T 10: 7,779,355 I41N probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm49368 C T 7: 128,112,226 R701C probably damaging Het
Gpr37 T A 6: 25,688,208 I297F probably benign Het
Gprc5a T A 6: 135,079,344 I263N possibly damaging Het
Gys2 A T 6: 142,454,451 S345T probably benign Het
Hk2 T C 6: 82,742,915 M255V possibly damaging Het
Ibtk A C 9: 85,697,237 S1202A possibly damaging Het
Il23r T G 6: 67,423,981 D455A probably benign Het
Irs2 T A 8: 11,006,522 K637* probably null Het
Jak2 T C 19: 29,283,546 V314A probably benign Het
Mei1 C T 15: 82,082,623 probably benign Het
Mill1 T C 7: 18,262,466 M69T probably benign Het
Mms22l T C 4: 24,598,884 probably null Het
Mup8 C A 4: 60,220,332 Q133H probably benign Het
Mup8 T A 4: 60,220,333 Q133L probably benign Het
Mycbp2 A T 14: 103,191,619 Y2374N probably damaging Het
Nbeal1 A T 1: 60,257,450 K1166N probably damaging Het
Nlrc4 T A 17: 74,448,196 R8S probably benign Het
Nrcam C T 12: 44,549,898 Q25* probably null Het
Nudt16 A C 9: 105,131,561 M47R probably damaging Het
Nup62 T C 7: 44,828,995 S145P probably benign Het
Olfr1222 T C 2: 89,124,989 I247M possibly damaging Het
Olfr959 A G 9: 39,572,465 W265R probably benign Het
Osbpl1a A T 18: 12,933,600 V34D probably benign Het
Otogl T A 10: 107,876,921 N521Y probably damaging Het
Pex5l T C 3: 33,082,151 probably benign Het
Pkhd1 A G 1: 20,562,415 L592P probably damaging Het
Plxdc2 A G 2: 16,729,376 H480R probably benign Het
Rnf216 T A 5: 143,080,236 K532N probably damaging Het
Schip1 C A 3: 68,617,695 Q358K probably damaging Het
Sdc2 A T 15: 33,028,087 E117V possibly damaging Het
Sept11 A T 5: 93,171,464 probably null Het
Shprh A T 10: 11,162,180 E420V probably benign Het
Ska1 T A 18: 74,196,973 H232L probably benign Het
Slc36a4 A G 9: 15,719,660 N25S possibly damaging Het
Slitrk3 G A 3: 73,050,839 T200M probably damaging Het
Smad2 C T 18: 76,288,013 H138Y probably benign Het
Snx21 T C 2: 164,786,165 S34P probably damaging Het
Sos2 A G 12: 69,648,585 V126A probably damaging Het
Srcap C T 7: 127,530,794 T596I probably damaging Het
Stk31 T G 6: 49,406,943 probably null Het
Stox1 T C 10: 62,663,964 D939G probably damaging Het
Syne2 G T 12: 76,061,779 C979F possibly damaging Het
Tanc2 C A 11: 105,776,858 N88K possibly damaging Het
Tll2 A T 19: 41,096,008 V677E probably damaging Het
Ttn T C 2: 76,918,490 T4072A probably benign Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Unc13b AGAGCC AGAGCCCGAGCC 4: 43,177,330 probably benign Het
Unc13b CAGAGC CAGAGCGAGAGC 4: 43,177,341 probably benign Het
Vmn2r43 A T 7: 8,255,254 F320Y possibly damaging Het
Zscan4f G T 7: 11,401,278 G204* probably null Het
Other mutations in Pcdhb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Pcdhb14 APN 18 37450033 missense probably benign 0.28
IGL02314:Pcdhb14 APN 18 37450195 missense probably benign 0.03
IGL02411:Pcdhb14 APN 18 37449770 missense possibly damaging 0.78
IGL02553:Pcdhb14 APN 18 37448018 nonsense probably null
IGL02797:Pcdhb14 APN 18 37449851 missense probably damaging 1.00
IGL03184:Pcdhb14 APN 18 37449032 missense probably benign 0.00
IGL03352:Pcdhb14 APN 18 37449004 missense possibly damaging 0.67
R0166:Pcdhb14 UTSW 18 37448489 splice site probably null
R0467:Pcdhb14 UTSW 18 37449224 missense probably damaging 0.98
R0675:Pcdhb14 UTSW 18 37448339 missense possibly damaging 0.91
R0730:Pcdhb14 UTSW 18 37448868 missense probably damaging 1.00
R1119:Pcdhb14 UTSW 18 37448587 missense probably damaging 0.99
R1121:Pcdhb14 UTSW 18 37449592 missense probably damaging 1.00
R1338:Pcdhb14 UTSW 18 37449890 missense probably benign 0.00
R1726:Pcdhb14 UTSW 18 37449594 nonsense probably null
R1743:Pcdhb14 UTSW 18 37448178 missense probably benign 0.01
R1779:Pcdhb14 UTSW 18 37449482 missense probably damaging 1.00
R1795:Pcdhb14 UTSW 18 37449535 missense probably benign
R2131:Pcdhb14 UTSW 18 37447870 missense probably benign 0.00
R2133:Pcdhb14 UTSW 18 37447870 missense probably benign 0.00
R3792:Pcdhb14 UTSW 18 37449662 missense probably damaging 1.00
R3916:Pcdhb14 UTSW 18 37448545 missense possibly damaging 0.48
R4197:Pcdhb14 UTSW 18 37448305 missense probably benign 0.01
R4282:Pcdhb14 UTSW 18 37450142 missense probably damaging 1.00
R4657:Pcdhb14 UTSW 18 37448847 missense possibly damaging 0.92
R4801:Pcdhb14 UTSW 18 37448278 missense probably benign 0.28
R4802:Pcdhb14 UTSW 18 37448278 missense probably benign 0.28
R5022:Pcdhb14 UTSW 18 37450170 missense probably benign 0.03
R5034:Pcdhb14 UTSW 18 37448806 missense probably damaging 0.98
R5664:Pcdhb14 UTSW 18 37448996 missense possibly damaging 0.54
R5840:Pcdhb14 UTSW 18 37448750 missense probably benign 0.23
R5966:Pcdhb14 UTSW 18 37448242 missense probably benign
R6090:Pcdhb14 UTSW 18 37448606 missense probably benign 0.45
R6148:Pcdhb14 UTSW 18 37449230 missense probably damaging 1.00
R6187:Pcdhb14 UTSW 18 37448444 missense probably damaging 1.00
R6972:Pcdhb14 UTSW 18 37449692 missense probably damaging 1.00
R7394:Pcdhb14 UTSW 18 37448908 missense probably benign 0.29
R7510:Pcdhb14 UTSW 18 37449592 missense probably damaging 0.97
R7724:Pcdhb14 UTSW 18 37448884 missense possibly damaging 0.62
R8305:Pcdhb14 UTSW 18 37450022 missense possibly damaging 0.48
R8338:Pcdhb14 UTSW 18 37449122 missense probably damaging 1.00
R8497:Pcdhb14 UTSW 18 37449296 missense probably benign 0.02
R8700:Pcdhb14 UTSW 18 37449599 missense probably damaging 1.00
R8792:Pcdhb14 UTSW 18 37449488 missense probably damaging 0.99
R8891:Pcdhb14 UTSW 18 37449639 missense probably damaging 1.00
R8992:Pcdhb14 UTSW 18 37449178 missense probably damaging 1.00
R9043:Pcdhb14 UTSW 18 37448798 missense probably damaging 0.98
R9069:Pcdhb14 UTSW 18 37450104 nonsense probably null
R9127:Pcdhb14 UTSW 18 37449038 missense probably damaging 0.99
R9345:Pcdhb14 UTSW 18 37448228 missense probably damaging 0.98
R9470:Pcdhb14 UTSW 18 37448023 missense probably benign
R9626:Pcdhb14 UTSW 18 37448734 missense probably damaging 1.00
R9758:Pcdhb14 UTSW 18 37448987 missense probably benign 0.08
X0065:Pcdhb14 UTSW 18 37449421 missense possibly damaging 0.95
X0065:Pcdhb14 UTSW 18 37449984 nonsense probably null
Z1177:Pcdhb14 UTSW 18 37449854 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATGCCTGGCTGTCATTCC -3'
(R):5'- AAAGTGTCCCTCAGGCACAG -3'

Sequencing Primer
(F):5'- GGCTGTCATTCCAACTGCTCAAG -3'
(R):5'- GAGCAGCCACCCAGAGAAGTC -3'
Posted On 2019-11-26