Mutagenetix > Incidental Mutation

Incidental Mutation 'R7758:Strc'

597654

Institutional Source

Beutler Lab

Gene Symbol

Strc

Ensembl Gene

ENSMUSG00000033498

Gene Name

stereocilin

Synonyms

DFNB16

MMRRC Submission

Accession Numbers

Genbank: NM_080459; MGI: 2153816

Essential gene?

Probably non essential (E-score: 0.206) question?

Stock #

R7758 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121363728-121387168 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121370946 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1259 (E1259G)

Ref Sequence

ENSEMBL: ENSMUSP00000039378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]

AlphaFold

Q8VIM6

Predicted Effect

probably benign
Transcript: ENSMUST00000038389
AA Change: E1259G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: E1259G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	74	87	N/A	INTRINSIC
low complexity region	108	119	N/A	INTRINSIC
low complexity region	132	161	N/A	INTRINSIC
low complexity region	277	291	N/A	INTRINSIC
low complexity region	376	425	N/A	INTRINSIC
low complexity region	610	635	N/A	INTRINSIC
low complexity region	656	677	N/A	INTRINSIC
low complexity region	728	746	N/A	INTRINSIC
low complexity region	898	921	N/A	INTRINSIC
low complexity region	1168	1194	N/A	INTRINSIC
low complexity region	1287	1302	N/A	INTRINSIC
low complexity region	1560	1580	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129136

SMART Domains

Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

Domain	Start	End	E-Value	Type
low complexity region	26	49	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

96% (48/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	A	G	3: 122,128,167	D1124G	probably damaging	Het
Actr10	A	G	12: 70,942,326	H73R	probably damaging	Het
Ak9	G	T	10: 41,347,132	A424S		Het
Alkbh5	G	A	11: 60,539,077	V219M	probably damaging	Het
Ankrd60	T	C	2: 173,568,769	*319W	probably null	Het
Bfar	T	C	16: 13,702,121	F406S	possibly damaging	Het
Brd4	A	G	17: 32,198,982	I1157T	unknown	Het
Card6	G	A	15: 5,099,896	Q673*	probably null	Het
Cdyl	T	A	13: 35,872,641	Y585N	probably damaging	Het
Cep192	A	C	18: 67,856,313	I1844L	possibly damaging	Het
Colec11	A	C	12: 28,595,242		probably null	Het
Crh	T	A	3: 19,694,289	Y63F	probably damaging	Het
Dmbt1	C	T	7: 131,121,197	H1946Y	unknown	Het
Dock4	C	T	12: 40,710,879	T522I	probably benign	Het
Fstl4	C	A	11: 53,168,296	D527E	possibly damaging	Het
Gm17019	A	G	5: 15,029,286	*256Q	probably null	Het
Gm5460	A	T	14: 34,035,157	T64S	probably benign	Het
Hist2h3b	A	G	3: 96,268,887	K65R	possibly damaging	Het
Hoxa9	A	T	6: 52,225,562	N181K	probably benign	Het
Ift81	A	T	5: 122,551,025	L676H	probably damaging	Het
Klhl35	C	T	7: 99,473,218	T87I	unknown	Het
Kmt2e	A	G	5: 23,496,070	T761A	possibly damaging	Het
Lca5l	C	T	16: 96,178,837	R36H	probably benign	Het
Lin7c	T	A	2: 109,896,372	I122K	probably damaging	Het
Malt1	A	G	18: 65,473,119	I622V	probably benign	Het
Megf8	T	C	7: 25,342,425		probably null	Het
Morc2b	A	G	17: 33,137,007	V597A	probably damaging	Het
Olfr1225	T	A	2: 89,171,141	I24L	probably benign	Het
Olfr229	T	G	9: 39,910,325	I174S	possibly damaging	Het
Olfr963	T	C	9: 39,669,075	M6T	probably benign	Het
Pdlim1	G	A	19: 40,243,542	P131S	probably benign	Het
Plekhh1	T	C	12: 79,070,804	I858T	probably benign	Het
Pls1	T	C	9: 95,776,844	N197S	probably benign	Het
Pnmal1	A	T	7: 16,961,299	T360S	probably benign	Het
Pon1	A	T	6: 5,168,344	D354E	probably benign	Het
Prss43	G	A	9: 110,829,391	G253E	possibly damaging	Het
Rbp3	G	A	14: 33,954,775	V227M	probably benign	Het
Slc22a15	A	G	3: 101,897,935		probably null	Het
Slc7a11	A	G	3: 50,372,360	I484T	probably benign	Het
Snrpa	A	G	7: 27,192,946	V63A	possibly damaging	Het
Sphk1	A	G	11: 116,536,237	R340G	possibly damaging	Het
Suds3	T	G	5: 117,115,737	D26A	unknown	Het
Taok3	A	G	5: 117,250,907	E459G	probably damaging	Het
Unc13b	CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC	CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC	4: 43,177,312		probably benign	Het
Unc13b	AGCCAG	AGCCAGCGCCAG	4: 43,177,344		probably benign	Het
Vmn1r201	A	G	13: 22,474,819	T68A	not run	Het
Wdr59	T	A	8: 111,480,485	I534F		Het
Ylpm1	A	G	12: 85,015,022	I566V	unknown	Het
Zbtb4	A	G	11: 69,778,542	E697G	probably benign	Het
Zcchc14	T	C	8: 121,604,689	K645R	unknown	Het
Zfp704	C	T	3: 9,444,222	V388M	possibly damaging	Het
Zfp994	T	C	17: 22,200,847	T374A	possibly damaging	Het

Other mutations in Strc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Strc	APN	2	121365060	missense	probably benign	0.39
IGL01152:Strc	APN	2	121370795	missense	probably benign
IGL01608:Strc	APN	2	121375594	missense	probably benign	0.05
IGL01695:Strc	APN	2	121375298	missense	probably damaging	1.00
IGL01715:Strc	APN	2	121365737	splice site	probably null
IGL01906:Strc	APN	2	121377634	missense	probably benign
IGL02135:Strc	APN	2	121364834	missense	probably damaging	1.00
IGL02416:Strc	APN	2	121369058	missense	probably damaging	1.00
IGL02455:Strc	APN	2	121375791	unclassified	probably benign
IGL03029:Strc	APN	2	121364044	missense	possibly damaging	0.95
IGL03176:Strc	APN	2	121372180	missense	probably damaging	0.99
IGL03272:Strc	APN	2	121371751	missense	probably damaging	1.00
3-1:Strc	UTSW	2	121373680	missense	probably damaging	0.99
IGL02799:Strc	UTSW	2	121379236	missense	probably damaging	1.00
PIT4283001:Strc	UTSW	2	121375307	missense	probably damaging	1.00
R0022:Strc	UTSW	2	121368393	missense	probably damaging	1.00
R0494:Strc	UTSW	2	121379533	missense	probably damaging	0.99
R1065:Strc	UTSW	2	121366651	missense	probably damaging	1.00
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1203:Strc	UTSW	2	121372123	missense	possibly damaging	0.66
R1343:Strc	UTSW	2	121365115	missense	probably benign	0.21
R1544:Strc	UTSW	2	121372738	splice site	probably null
R1650:Strc	UTSW	2	121380885	start gained	probably benign
R1840:Strc	UTSW	2	121379296	missense	probably damaging	1.00
R1983:Strc	UTSW	2	121371037	missense	possibly damaging	0.54
R2035:Strc	UTSW	2	121374934	missense	probably damaging	1.00
R2058:Strc	UTSW	2	121378887	missense	probably damaging	1.00
R2158:Strc	UTSW	2	121365862	missense	probably benign	0.10
R2219:Strc	UTSW	2	121364523	missense	probably damaging	1.00
R2680:Strc	UTSW	2	121365111	missense	probably damaging	0.99
R4375:Strc	UTSW	2	121380823	missense	unknown
R4563:Strc	UTSW	2	121365805	missense	probably benign	0.02
R4578:Strc	UTSW	2	121378003	missense	possibly damaging	0.94
R4607:Strc	UTSW	2	121372945	missense	probably benign	0.31
R4651:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4652:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4790:Strc	UTSW	2	121375594	missense	probably benign	0.05
R5480:Strc	UTSW	2	121364819	missense	probably benign	0.00
R5580:Strc	UTSW	2	121375012	missense	probably damaging	0.99
R5679:Strc	UTSW	2	121368100	missense	probably benign	0.03
R5703:Strc	UTSW	2	121370814	missense	probably benign
R5841:Strc	UTSW	2	121365877	missense	probably benign	0.29
R5917:Strc	UTSW	2	121379309	missense	probably benign
R5958:Strc	UTSW	2	121376922	missense	possibly damaging	0.56
R6320:Strc	UTSW	2	121374958	missense	probably benign	0.16
R6619:Strc	UTSW	2	121368432	missense	probably damaging	0.99
R6695:Strc	UTSW	2	121377224	missense	probably benign	0.35
R6970:Strc	UTSW	2	121378014	missense	probably benign	0.41
R7018:Strc	UTSW	2	121369058	missense	probably damaging	1.00
R7045:Strc	UTSW	2	121370726	missense	probably damaging	1.00
R7190:Strc	UTSW	2	121369026	missense	probably benign	0.14
R7283:Strc	UTSW	2	121379452	missense	probably damaging	0.99
R7694:Strc	UTSW	2	121377096	missense	probably damaging	1.00
R7699:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7700:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7756:Strc	UTSW	2	121370946	missense	probably benign
R7822:Strc	UTSW	2	121377738	missense	probably benign	0.01
R7830:Strc	UTSW	2	121375049	missense	probably damaging	0.99
R7953:Strc	UTSW	2	121377363	missense	probably damaging	0.99
R8137:Strc	UTSW	2	121366738	missense	probably damaging	0.98
R8394:Strc	UTSW	2	121379009	missense	probably benign	0.00
R8427:Strc	UTSW	2	121377531	missense	probably damaging	1.00
R8792:Strc	UTSW	2	121377805	missense	probably damaging	0.99
R8874:Strc	UTSW	2	121374872	critical splice donor site	probably null
R8947:Strc	UTSW	2	121370989	missense	probably benign	0.09
R9285:Strc	UTSW	2	121364798	missense	probably damaging	1.00
R9302:Strc	UTSW	2	121380855	missense	unknown
R9386:Strc	UTSW	2	121367730	missense	probably damaging	0.99
R9438:Strc	UTSW	2	121368166	missense	probably damaging	1.00
R9581:Strc	UTSW	2	121377447	missense	probably damaging	0.99
Z1176:Strc	UTSW	2	121375521	missense	probably damaging	0.98
Z1176:Strc	UTSW	2	121379044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACTCAGTTCTGGCCCTAG -3'
(R):5'- ATCTGCCTTTGTGCTGAGAG -3'

Sequencing Primer
(F):5'- CCTAGGGTGGTCAGCTCTG -3'
(R):5'- CTGGTATTGAGGATCAGGCAGGC -3'

Posted On

2019-11-26