Mutagenetix > Incidental Mutations

Incidental Mutation 'R7758:Abca4'

597661

Institutional Source

Beutler Lab

Gene Symbol

Abca4

Ensembl Gene

ENSMUSG00000028125

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 4

Synonyms

D430003I15Rik, Abc10, Rim protein, RmP

MMRRC Submission

Accession Numbers

Genbank: NM_007378; MGI: 109424

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7758 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

122044443-122180123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122128167 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1124 (D1124G)

Ref Sequence

ENSEMBL: ENSMUSP00000013995 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013995] [ENSMUST00000141135]

AlphaFold

O35600

Predicted Effect

probably damaging
Transcript: ENSMUST00000013995
AA Change: D1124G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000013995
Gene: ENSMUSG00000028125
AA Change: D1124G

Domain	Start	End	E-Value	Type
transmembrane domain	23	42	N/A	INTRINSIC
Pfam:ABC2_membrane_3	608	856	5e-17	PFAM
AAA	955	1145	9.42e-13	SMART
transmembrane domain	1372	1394	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1522	1894	2.9e-44	PFAM
AAA	1963	2147	7.09e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000141135

SMART Domains

Protein: ENSMUSP00000143560
Gene: ENSMUSG00000028125

Domain	Start	End	E-Value	Type
Blast:AAA	1	172	9e-78	BLAST
Pfam:ABC2_membrane_3	311	686	1.9e-42	PFAM
AAA	755	939	1.2e-9	SMART

Meta Mutation Damage Score

0.7844

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

96% (48/50)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein was the first of the ABC transporters to be observed in photoreceptors and may play a role in the photoresponse. Mutations in the human gene are found in patients diagnosed with Stargardt disease and are associated with retinitis pigmentosa-19 and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display delayed rod dark adaptation and are a model for juvenile macular degeneration. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr10	A	G	12: 70,942,326	H73R	probably damaging	Het
Ak9	G	T	10: 41,347,132	A424S		Het
Alkbh5	G	A	11: 60,539,077	V219M	probably damaging	Het
Ankrd60	T	C	2: 173,568,769	*319W	probably null	Het
Bfar	T	C	16: 13,702,121	F406S	possibly damaging	Het
Brd4	A	G	17: 32,198,982	I1157T	unknown	Het
Card6	G	A	15: 5,099,896	Q673*	probably null	Het
Cdyl	T	A	13: 35,872,641	Y585N	probably damaging	Het
Cep192	A	C	18: 67,856,313	I1844L	possibly damaging	Het
Colec11	A	C	12: 28,595,242		probably null	Het
Crh	T	A	3: 19,694,289	Y63F	probably damaging	Het
Dmbt1	C	T	7: 131,121,197	H1946Y	unknown	Het
Dock4	C	T	12: 40,710,879	T522I	probably benign	Het
Fstl4	C	A	11: 53,168,296	D527E	possibly damaging	Het
Gm17019	A	G	5: 15,029,286	*256Q	probably null	Het
Gm5460	A	T	14: 34,035,157	T64S	probably benign	Het
Hist2h3b	A	G	3: 96,268,887	K65R	possibly damaging	Het
Hoxa9	A	T	6: 52,225,562	N181K	probably benign	Het
Ift81	A	T	5: 122,551,025	L676H	probably damaging	Het
Klhl35	C	T	7: 99,473,218	T87I	unknown	Het
Kmt2e	A	G	5: 23,496,070	T761A	possibly damaging	Het
Lca5l	C	T	16: 96,178,837	R36H	probably benign	Het
Lin7c	T	A	2: 109,896,372	I122K	probably damaging	Het
Malt1	A	G	18: 65,473,119	I622V	probably benign	Het
Megf8	T	C	7: 25,342,425		probably null	Het
Morc2b	A	G	17: 33,137,007	V597A	probably damaging	Het
Olfr1225	T	A	2: 89,171,141	I24L	probably benign	Het
Olfr229	T	G	9: 39,910,325	I174S	possibly damaging	Het
Olfr963	T	C	9: 39,669,075	M6T	probably benign	Het
Pdlim1	G	A	19: 40,243,542	P131S	probably benign	Het
Plekhh1	T	C	12: 79,070,804	I858T	probably benign	Het
Pls1	T	C	9: 95,776,844	N197S	probably benign	Het
Pnmal1	A	T	7: 16,961,299	T360S	probably benign	Het
Pon1	A	T	6: 5,168,344	D354E	probably benign	Het
Prss43	G	A	9: 110,829,391	G253E	possibly damaging	Het
Rbp3	G	A	14: 33,954,775	V227M	probably benign	Het
Slc22a15	A	G	3: 101,897,935		probably null	Het
Slc7a11	A	G	3: 50,372,360	I484T	probably benign	Het
Snrpa	A	G	7: 27,192,946	V63A	possibly damaging	Het
Sphk1	A	G	11: 116,536,237	R340G	possibly damaging	Het
Strc	T	C	2: 121,370,946	E1259G	probably benign	Het
Suds3	T	G	5: 117,115,737	D26A	unknown	Het
Taok3	A	G	5: 117,250,907	E459G	probably damaging	Het
Unc13b	CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC	CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC	4: 43,177,312		probably benign	Het
Unc13b	AGCCAG	AGCCAGCGCCAG	4: 43,177,344		probably benign	Het
Vmn1r201	A	G	13: 22,474,819	T68A	not run	Het
Wdr59	T	A	8: 111,480,485	I534F		Het
Ylpm1	A	G	12: 85,015,022	I566V	unknown	Het
Zbtb4	A	G	11: 69,778,542	E697G	probably benign	Het
Zcchc14	T	C	8: 121,604,689	K645R	unknown	Het
Zfp704	C	T	3: 9,444,222	V388M	possibly damaging	Het
Zfp994	T	C	17: 22,200,847	T374A	possibly damaging	Het

Other mutations in Abca4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Abca4	APN	3	122062704	splice site	probably null
IGL00229:Abca4	APN	3	122170954	missense	probably damaging	1.00
IGL00858:Abca4	APN	3	122173888	missense	probably damaging	0.97
IGL01316:Abca4	APN	3	122141755	missense	probably damaging	0.99
IGL01357:Abca4	APN	3	122103583	missense	probably damaging	1.00
IGL01784:Abca4	APN	3	122138505	missense	probably benign	0.22
IGL01903:Abca4	APN	3	122155401	splice site	probably benign
IGL02008:Abca4	APN	3	122176101	missense	probably benign	0.00
IGL02113:Abca4	APN	3	122110478	missense	possibly damaging	0.90
IGL02142:Abca4	APN	3	122169926	missense	probably benign	0.01
IGL02200:Abca4	APN	3	122069014	missense	probably benign	0.00
IGL02203:Abca4	APN	3	122179808	missense	probably benign
IGL02306:Abca4	APN	3	122158395	missense	probably damaging	1.00
IGL02307:Abca4	APN	3	122141746	missense	probably damaging	1.00
IGL02673:Abca4	APN	3	122103501	missense	probably damaging	1.00
IGL02864:Abca4	APN	3	122143431	missense	probably damaging	1.00
IGL02886:Abca4	APN	3	122128214	missense	probably damaging	0.96
IGL02934:Abca4	APN	3	122162359	nonsense	probably null
IGL02992:Abca4	APN	3	122128286	missense	probably damaging	0.96
IGL03083:Abca4	APN	3	122138612	critical splice donor site	probably null
IGL03258:Abca4	APN	3	122137561	splice site	probably benign
IGL03279:Abca4	APN	3	122141732	missense	probably benign	0.12
3-1:Abca4	UTSW	3	122080925	missense	probably benign	0.01
B6819:Abca4	UTSW	3	122103624	splice site	probably benign
K7894:Abca4	UTSW	3	122147868	frame shift	probably null
PIT4151001:Abca4	UTSW	3	122137021	missense	probably damaging	0.99
PIT4453001:Abca4	UTSW	3	122105316	missense	probably damaging	0.99
R0001:Abca4	UTSW	3	122081011	splice site	probably benign
R0091:Abca4	UTSW	3	122138530	missense	possibly damaging	0.94
R0138:Abca4	UTSW	3	122105449	missense	probably damaging	1.00
R0344:Abca4	UTSW	3	122083964	missense	probably damaging	1.00
R0347:Abca4	UTSW	3	122120099	missense	probably benign	0.00
R0508:Abca4	UTSW	3	122123551	splice site	probably benign
R0607:Abca4	UTSW	3	122156432	missense	probably damaging	1.00
R0835:Abca4	UTSW	3	122126213	missense	probably damaging	1.00
R0839:Abca4	UTSW	3	122126878	missense	probably damaging	0.99
R1138:Abca4	UTSW	3	122173848	missense	probably benign	0.13
R1448:Abca4	UTSW	3	122162928	splice site	probably null
R1453:Abca4	UTSW	3	122069114	missense	probably benign	0.04
R1533:Abca4	UTSW	3	122135158	missense	probably benign	0.07
R1645:Abca4	UTSW	3	122155277	missense	probably benign	0.00
R1763:Abca4	UTSW	3	122110681	missense	probably benign	0.09
R1763:Abca4	UTSW	3	122163830	missense	probably damaging	1.00
R1838:Abca4	UTSW	3	122128305	missense	probably benign
R1867:Abca4	UTSW	3	122105361	missense	probably damaging	1.00
R1907:Abca4	UTSW	3	122069012	missense	probably damaging	0.99
R1935:Abca4	UTSW	3	122052923	missense	probably benign	0.00
R1936:Abca4	UTSW	3	122052923	missense	probably benign	0.00
R2165:Abca4	UTSW	3	122112399	missense	possibly damaging	0.90
R2391:Abca4	UTSW	3	122158422	missense	probably benign	0.00
R2403:Abca4	UTSW	3	122170943	missense	probably damaging	1.00
R3788:Abca4	UTSW	3	122052912	missense	possibly damaging	0.50
R3814:Abca4	UTSW	3	122170921	splice site	probably benign
R4554:Abca4	UTSW	3	122156343	missense	possibly damaging	0.91
R4649:Abca4	UTSW	3	122169893	missense	probably damaging	1.00
R4653:Abca4	UTSW	3	122138581	nonsense	probably null
R4655:Abca4	UTSW	3	122147498	missense	possibly damaging	0.93
R4668:Abca4	UTSW	3	122155299	missense	possibly damaging	0.90
R4705:Abca4	UTSW	3	122105370	missense	probably damaging	0.98
R4788:Abca4	UTSW	3	122166712	missense	probably damaging	1.00
R4795:Abca4	UTSW	3	122176123	missense	probably damaging	0.99
R4999:Abca4	UTSW	3	122105370	missense	probably damaging	1.00
R5301:Abca4	UTSW	3	122102853	missense	probably damaging	0.96
R5372:Abca4	UTSW	3	122055339	missense	probably damaging	0.96
R5395:Abca4	UTSW	3	122080941	missense	probably benign	0.00
R5539:Abca4	UTSW	3	122169908	missense	probably damaging	1.00
R5583:Abca4	UTSW	3	122148901	missense	probably damaging	0.99
R5706:Abca4	UTSW	3	122054261	missense	probably benign	0.10
R5719:Abca4	UTSW	3	122135266	critical splice donor site	probably null
R5731:Abca4	UTSW	3	122132593	missense	probably damaging	1.00
R5802:Abca4	UTSW	3	122054232	missense	probably damaging	1.00
R5819:Abca4	UTSW	3	122136981	missense	probably damaging	0.97
R5853:Abca4	UTSW	3	122103531	missense	probably benign
R6053:Abca4	UTSW	3	122171017	missense	probably damaging	0.99
R6135:Abca4	UTSW	3	122138447	missense	possibly damaging	0.69
R6185:Abca4	UTSW	3	122126140	missense	probably damaging	0.97
R6227:Abca4	UTSW	3	122137094	nonsense	probably null
R6293:Abca4	UTSW	3	122141746	missense	probably damaging	1.00
R6297:Abca4	UTSW	3	122132530	missense	probably benign	0.24
R6367:Abca4	UTSW	3	122103580	missense	probably damaging	1.00
R6376:Abca4	UTSW	3	122123660	missense	possibly damaging	0.95
R6405:Abca4	UTSW	3	122173662	splice site	probably null
R6525:Abca4	UTSW	3	122137659	missense	probably benign	0.00
R6602:Abca4	UTSW	3	122138501	missense	probably benign	0.00
R6681:Abca4	UTSW	3	122121798	missense	probably damaging	1.00
R6747:Abca4	UTSW	3	122126313	splice site	probably null
R6852:Abca4	UTSW	3	122135195	missense	probably damaging	0.99
R7049:Abca4	UTSW	3	122147848	missense	probably benign	0.00
R7072:Abca4	UTSW	3	122173943	missense	probably damaging	1.00
R7092:Abca4	UTSW	3	122138569	missense	probably damaging	1.00
R7110:Abca4	UTSW	3	122132643	missense	probably damaging	1.00
R7138:Abca4	UTSW	3	122105464	nonsense	probably null
R7172:Abca4	UTSW	3	122103540	nonsense	probably null
R7263:Abca4	UTSW	3	122054194	missense	probably damaging	0.99
R7414:Abca4	UTSW	3	122102738	missense	probably benign	0.28
R7537:Abca4	UTSW	3	122173988	missense	possibly damaging	0.68
R7577:Abca4	UTSW	3	122174014	missense	probably damaging	1.00
R7665:Abca4	UTSW	3	122044490	start gained	probably benign
R7935:Abca4	UTSW	3	122110537	missense	possibly damaging	0.85
R8237:Abca4	UTSW	3	122162303	missense	probably benign	0.00
R8255:Abca4	UTSW	3	122155277	missense	probably benign	0.00
R8294:Abca4	UTSW	3	122103568	missense	possibly damaging	0.75
R8504:Abca4	UTSW	3	122129334	missense	probably benign	0.01
R8536:Abca4	UTSW	3	122179745	missense	probably benign	0.01
R8714:Abca4	UTSW	3	122148879	missense	probably benign	0.19
R8771:Abca4	UTSW	3	122086671	missense	probably damaging	0.97
R8835:Abca4	UTSW	3	122102784	missense	probably benign	0.00
R8845:Abca4	UTSW	3	122137002	missense	probably damaging	1.00
R8856:Abca4	UTSW	3	122112447	missense	probably benign
R8933:Abca4	UTSW	3	122128137	missense	probably damaging	1.00
R9052:Abca4	UTSW	3	122147259	missense	possibly damaging	0.68
R9095:Abca4	UTSW	3	122173907	missense	possibly damaging	0.52
R9221:Abca4	UTSW	3	122128179	missense	probably damaging	1.00
R9262:Abca4	UTSW	3	122170990	missense	probably damaging	1.00
R9301:Abca4	UTSW	3	122087479	missense	probably benign	0.24
R9367:Abca4	UTSW	3	122044548	start codon destroyed	probably null	0.99
R9408:Abca4	UTSW	3	122137625	missense	probably benign
R9425:Abca4	UTSW	3	122132695	missense	probably damaging	1.00
Z1176:Abca4	UTSW	3	122103488	missense	probably damaging	1.00
Z1176:Abca4	UTSW	3	122156443	missense	probably damaging	1.00
Z1177:Abca4	UTSW	3	122147786	missense	possibly damaging	0.79
Z1177:Abca4	UTSW	3	122173914	missense	probably benign	0.21
Z1189:Abca4	UTSW	3	122083993	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- AGTGGTTGCTATCATCGTTACTCC -3'
(R):5'- TATTTCCAGAACAGCAGCCC -3'

Sequencing Primer
(F):5'- GTTGCTATCATCGTTACTCCATTATG -3'
(R):5'- AAGCTGGGCTCCTTCCC -3'

Posted On

2019-11-26