Incidental Mutation 'R7758:Klhl35'
ID597674
Institutional Source Beutler Lab
Gene Symbol Klhl35
Ensembl Gene ENSMUSG00000035298
Gene Namekelch-like 35
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R7758 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location99466004-99474022 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99473218 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 87 (T87I)
Ref Sequence ENSEMBL: ENSMUSP00000120346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032998] [ENSMUST00000037359] [ENSMUST00000107096] [ENSMUST00000152424]
Predicted Effect probably benign
Transcript: ENSMUST00000032998
SMART Domains Protein: ENSMUSP00000032998
Gene: ENSMUSG00000030744

DomainStartEndE-ValueType
KH 42 111 2.83e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000037359
SMART Domains Protein: ENSMUSP00000041363
Gene: ENSMUSG00000035298

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
BTB 40 141 5.82e-17 SMART
BACK 146 248 1.21e-27 SMART
Kelch 292 341 6.32e-2 SMART
Kelch 342 385 1.18e-5 SMART
Kelch 386 432 3.01e-12 SMART
Kelch 433 480 2.23e-1 SMART
Kelch 481 522 2.71e-5 SMART
Kelch 523 570 1.39e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107096
SMART Domains Protein: ENSMUSP00000102713
Gene: ENSMUSG00000030744

DomainStartEndE-ValueType
KH 42 111 2.83e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000152424
AA Change: T87I
SMART Domains Protein: ENSMUSP00000120346
Gene: ENSMUSG00000035298
AA Change: T87I

DomainStartEndE-ValueType
Pfam:Kelch_1 1 34 1.1e-8 PFAM
Pfam:Kelch_6 36 79 3.6e-8 PFAM
Pfam:Kelch_1 38 76 2.6e-7 PFAM
low complexity region 106 119 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153736
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,128,167 D1124G probably damaging Het
Actr10 A G 12: 70,942,326 H73R probably damaging Het
Ak9 G T 10: 41,347,132 A424S Het
Alkbh5 G A 11: 60,539,077 V219M probably damaging Het
Ankrd60 T C 2: 173,568,769 *319W probably null Het
Bfar T C 16: 13,702,121 F406S possibly damaging Het
Brd4 A G 17: 32,198,982 I1157T unknown Het
Card6 G A 15: 5,099,896 Q673* probably null Het
Cdyl T A 13: 35,872,641 Y585N probably damaging Het
Cep192 A C 18: 67,856,313 I1844L possibly damaging Het
Colec11 A C 12: 28,595,242 probably null Het
Crh T A 3: 19,694,289 Y63F probably damaging Het
Dmbt1 C T 7: 131,121,197 H1946Y unknown Het
Dock4 C T 12: 40,710,879 T522I probably benign Het
Fstl4 C A 11: 53,168,296 D527E possibly damaging Het
Gm17019 A G 5: 15,029,286 *256Q probably null Het
Gm5460 A T 14: 34,035,157 T64S probably benign Het
Hist2h3b A G 3: 96,268,887 K65R possibly damaging Het
Hoxa9 A T 6: 52,225,562 N181K probably benign Het
Ift81 A T 5: 122,551,025 L676H probably damaging Het
Kmt2e A G 5: 23,496,070 T761A possibly damaging Het
Lca5l C T 16: 96,178,837 R36H probably benign Het
Lin7c T A 2: 109,896,372 I122K probably damaging Het
Malt1 A G 18: 65,473,119 I622V probably benign Het
Megf8 T C 7: 25,342,425 probably null Het
Morc2b A G 17: 33,137,007 V597A probably damaging Het
Olfr1225 T A 2: 89,171,141 I24L probably benign Het
Olfr229 T G 9: 39,910,325 I174S possibly damaging Het
Olfr963 T C 9: 39,669,075 M6T probably benign Het
Pdlim1 G A 19: 40,243,542 P131S probably benign Het
Plekhh1 T C 12: 79,070,804 I858T probably benign Het
Pls1 T C 9: 95,776,844 N197S probably benign Het
Pnmal1 A T 7: 16,961,299 T360S probably benign Het
Pon1 A T 6: 5,168,344 D354E probably benign Het
Prss43 G A 9: 110,829,391 G253E possibly damaging Het
Rbp3 G A 14: 33,954,775 V227M probably benign Het
Slc22a15 A G 3: 101,897,935 probably null Het
Slc7a11 A G 3: 50,372,360 I484T probably benign Het
Snrpa A G 7: 27,192,946 V63A possibly damaging Het
Sphk1 A G 11: 116,536,237 R340G possibly damaging Het
Strc T C 2: 121,370,946 E1259G probably benign Het
Suds3 T G 5: 117,115,737 D26A unknown Het
Taok3 A G 5: 117,250,907 E459G probably damaging Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Unc13b AGCCAG AGCCAGCGCCAG 4: 43,177,344 probably benign Het
Vmn1r201 A G 13: 22,474,819 T68A not run Het
Wdr59 T A 8: 111,480,485 I534F Het
Ylpm1 A G 12: 85,015,022 I566V unknown Het
Zbtb4 A G 11: 69,778,542 E697G probably benign Het
Zcchc14 T C 8: 121,604,689 K645R unknown Het
Zfp704 C T 3: 9,444,222 V388M possibly damaging Het
Zfp994 T C 17: 22,200,847 T374A possibly damaging Het
Other mutations in Klhl35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Klhl35 APN 7 99471681 splice site probably benign
IGL03003:Klhl35 APN 7 99470343 missense probably damaging 0.98
R0268:Klhl35 UTSW 7 99471751 missense probably benign 0.33
R1563:Klhl35 UTSW 7 99471695 missense probably damaging 1.00
R1770:Klhl35 UTSW 7 99473875 missense possibly damaging 0.57
R1901:Klhl35 UTSW 7 99470220 missense probably damaging 1.00
R2392:Klhl35 UTSW 7 99473824 missense possibly damaging 0.72
R3810:Klhl35 UTSW 7 99470241 missense probably benign 0.07
R4194:Klhl35 UTSW 7 99473851 unclassified probably null
R4349:Klhl35 UTSW 7 99473719 missense probably benign 0.18
R4960:Klhl35 UTSW 7 99469068 missense probably damaging 1.00
R5846:Klhl35 UTSW 7 99472887 missense probably damaging 0.97
R6161:Klhl35 UTSW 7 99473337 unclassified probably benign
R6494:Klhl35 UTSW 7 99472899 missense probably damaging 1.00
R7060:Klhl35 UTSW 7 99468458 missense possibly damaging 0.81
R7762:Klhl35 UTSW 7 99468440 missense probably benign 0.11
X0023:Klhl35 UTSW 7 99470341 nonsense probably null
X0064:Klhl35 UTSW 7 99471841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGTCTTGCATGATCCCAC -3'
(R):5'- AAGTTGGAAGCCTCAGCCTTG -3'

Sequencing Primer
(F):5'- GCATGATCCCACTGTAAATGG -3'
(R):5'- TTGAGTCATCCAGGACCCAAATGG -3'
Posted On2019-11-26