Incidental Mutation 'R7758:Olfr229'
ID 597679
Institutional Source Beutler Lab
Gene Symbol Olfr229
Ensembl Gene ENSMUSG00000095390
Gene Name olfactory receptor 229
Synonyms GA_x6K02T02EEW-227-373, MOR171-14, Olfr973, GA_x6K02T2PVTD-33608180-33608971
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R7758 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 39907336-39912732 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 39910325 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 174 (I174S)
Ref Sequence ENSEMBL: ENSMUSP00000149063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076802] [ENSMUST00000214904]
AlphaFold Q8VFN5
Predicted Effect possibly damaging
Transcript: ENSMUST00000076802
AA Change: I174S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000076080
Gene: ENSMUSG00000095390
AA Change: I174S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4.7e-51 PFAM
Pfam:7tm_1 41 290 7.1e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214904
AA Change: I174S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,128,167 D1124G probably damaging Het
Actr10 A G 12: 70,942,326 H73R probably damaging Het
Ak9 G T 10: 41,347,132 A424S Het
Alkbh5 G A 11: 60,539,077 V219M probably damaging Het
Ankrd60 T C 2: 173,568,769 *319W probably null Het
Bfar T C 16: 13,702,121 F406S possibly damaging Het
Brd4 A G 17: 32,198,982 I1157T unknown Het
Card6 G A 15: 5,099,896 Q673* probably null Het
Cdyl T A 13: 35,872,641 Y585N probably damaging Het
Cep192 A C 18: 67,856,313 I1844L possibly damaging Het
Colec11 A C 12: 28,595,242 probably null Het
Crh T A 3: 19,694,289 Y63F probably damaging Het
Dmbt1 C T 7: 131,121,197 H1946Y unknown Het
Dock4 C T 12: 40,710,879 T522I probably benign Het
Fstl4 C A 11: 53,168,296 D527E possibly damaging Het
Gm17019 A G 5: 15,029,286 *256Q probably null Het
Gm5460 A T 14: 34,035,157 T64S probably benign Het
Hist2h3b A G 3: 96,268,887 K65R possibly damaging Het
Hoxa9 A T 6: 52,225,562 N181K probably benign Het
Ift81 A T 5: 122,551,025 L676H probably damaging Het
Klhl35 C T 7: 99,473,218 T87I unknown Het
Kmt2e A G 5: 23,496,070 T761A possibly damaging Het
Lca5l C T 16: 96,178,837 R36H probably benign Het
Lin7c T A 2: 109,896,372 I122K probably damaging Het
Malt1 A G 18: 65,473,119 I622V probably benign Het
Megf8 T C 7: 25,342,425 probably null Het
Morc2b A G 17: 33,137,007 V597A probably damaging Het
Olfr1225 T A 2: 89,171,141 I24L probably benign Het
Olfr963 T C 9: 39,669,075 M6T probably benign Het
Pdlim1 G A 19: 40,243,542 P131S probably benign Het
Plekhh1 T C 12: 79,070,804 I858T probably benign Het
Pls1 T C 9: 95,776,844 N197S probably benign Het
Pnmal1 A T 7: 16,961,299 T360S probably benign Het
Pon1 A T 6: 5,168,344 D354E probably benign Het
Prss43 G A 9: 110,829,391 G253E possibly damaging Het
Rbp3 G A 14: 33,954,775 V227M probably benign Het
Slc22a15 A G 3: 101,897,935 probably null Het
Slc7a11 A G 3: 50,372,360 I484T probably benign Het
Snrpa A G 7: 27,192,946 V63A possibly damaging Het
Sphk1 A G 11: 116,536,237 R340G possibly damaging Het
Strc T C 2: 121,370,946 E1259G probably benign Het
Suds3 T G 5: 117,115,737 D26A unknown Het
Taok3 A G 5: 117,250,907 E459G probably damaging Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Unc13b AGCCAG AGCCAGCGCCAG 4: 43,177,344 probably benign Het
Vmn1r201 A G 13: 22,474,819 T68A not run Het
Wdr59 T A 8: 111,480,485 I534F Het
Ylpm1 A G 12: 85,015,022 I566V unknown Het
Zbtb4 A G 11: 69,778,542 E697G probably benign Het
Zcchc14 T C 8: 121,604,689 K645R unknown Het
Zfp704 C T 3: 9,444,222 V388M possibly damaging Het
Zfp994 T C 17: 22,200,847 T374A possibly damaging Het
Other mutations in Olfr229
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Olfr229 APN 9 39910606 missense possibly damaging 0.94
IGL01880:Olfr229 APN 9 39909941 missense possibly damaging 0.95
IGL02142:Olfr229 APN 9 39910639 missense possibly damaging 0.75
IGL02366:Olfr229 APN 9 39909992 missense probably damaging 1.00
R0415:Olfr229 UTSW 9 39909983 missense probably damaging 1.00
R1383:Olfr229 UTSW 9 39909864 missense probably benign 0.10
R1838:Olfr229 UTSW 9 39909841 missense possibly damaging 0.90
R3196:Olfr229 UTSW 9 39910460 missense probably damaging 0.99
R3951:Olfr229 UTSW 9 39910725 missense probably benign 0.40
R4984:Olfr229 UTSW 9 39910610 missense probably benign 0.14
R5771:Olfr229 UTSW 9 39910250 missense probably damaging 1.00
R7454:Olfr229 UTSW 9 39909904 missense probably benign 0.02
R7756:Olfr229 UTSW 9 39910325 missense possibly damaging 0.95
R7868:Olfr229 UTSW 9 39909986 missense probably benign
R8670:Olfr229 UTSW 9 39910423 missense probably benign 0.02
R8963:Olfr229 UTSW 9 39910199 missense probably damaging 1.00
RF021:Olfr229 UTSW 9 39910045 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGCAATTGCAGAGTGTCAC -3'
(R):5'- GTGCTAAAGGCTTTGGACCTG -3'

Sequencing Primer
(F):5'- CAATTGCAGAGTGTCACATGTTG -3'
(R):5'- TGCCCTCAGTGGAGCGAATAC -3'
Posted On 2019-11-26