Mutagenetix > Incidental Mutations

Incidental Mutation 'R7758:Olfr229'

597679

Institutional Source

Beutler Lab

Gene Symbol

Olfr229

Ensembl Gene

ENSMUSG00000095390

Gene Name

olfactory receptor 229

Synonyms

GA_x6K02T02EEW-227-373, MOR171-14, Olfr973, GA_x6K02T2PVTD-33608180-33608971

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R7758 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

39907336-39912732 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 39910325 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 174 (I174S)

Ref Sequence

ENSEMBL: ENSMUSP00000149063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076802] [ENSMUST00000214904]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000076802
AA Change: I174S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000076080
Gene: ENSMUSG00000095390
AA Change: I174S

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	307	4.7e-51	PFAM
Pfam:7tm_1	41	290	7.1e-21	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214904
AA Change: I174S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

96% (48/50)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	A	G	3: 122,128,167	D1124G	probably damaging	Het
Actr10	A	G	12: 70,942,326	H73R	probably damaging	Het
Ak9	G	T	10: 41,347,132	A424S		Het
Alkbh5	G	A	11: 60,539,077	V219M	probably damaging	Het
Ankrd60	T	C	2: 173,568,769	*319W	probably null	Het
Bfar	T	C	16: 13,702,121	F406S	possibly damaging	Het
Brd4	A	G	17: 32,198,982	I1157T	unknown	Het
Card6	G	A	15: 5,099,896	Q673*	probably null	Het
Cdyl	T	A	13: 35,872,641	Y585N	probably damaging	Het
Cep192	A	C	18: 67,856,313	I1844L	possibly damaging	Het
Colec11	A	C	12: 28,595,242		probably null	Het
Crh	T	A	3: 19,694,289	Y63F	probably damaging	Het
Dmbt1	C	T	7: 131,121,197	H1946Y	unknown	Het
Dock4	C	T	12: 40,710,879	T522I	probably benign	Het
Fstl4	C	A	11: 53,168,296	D527E	possibly damaging	Het
Gm17019	A	G	5: 15,029,286	*256Q	probably null	Het
Gm5460	A	T	14: 34,035,157	T64S	probably benign	Het
Hist2h3b	A	G	3: 96,268,887	K65R	possibly damaging	Het
Hoxa9	A	T	6: 52,225,562	N181K	probably benign	Het
Ift81	A	T	5: 122,551,025	L676H	probably damaging	Het
Klhl35	C	T	7: 99,473,218	T87I	unknown	Het
Kmt2e	A	G	5: 23,496,070	T761A	possibly damaging	Het
Lca5l	C	T	16: 96,178,837	R36H	probably benign	Het
Lin7c	T	A	2: 109,896,372	I122K	probably damaging	Het
Malt1	A	G	18: 65,473,119	I622V	probably benign	Het
Megf8	T	C	7: 25,342,425		probably null	Het
Morc2b	A	G	17: 33,137,007	V597A	probably damaging	Het
Olfr1225	T	A	2: 89,171,141	I24L	probably benign	Het
Olfr963	T	C	9: 39,669,075	M6T	probably benign	Het
Pdlim1	G	A	19: 40,243,542	P131S	probably benign	Het
Plekhh1	T	C	12: 79,070,804	I858T	probably benign	Het
Pls1	T	C	9: 95,776,844	N197S	probably benign	Het
Pnmal1	A	T	7: 16,961,299	T360S	probably benign	Het
Pon1	A	T	6: 5,168,344	D354E	probably benign	Het
Prss43	G	A	9: 110,829,391	G253E	possibly damaging	Het
Rbp3	G	A	14: 33,954,775	V227M	probably benign	Het
Slc22a15	A	G	3: 101,897,935		probably null	Het
Slc7a11	A	G	3: 50,372,360	I484T	probably benign	Het
Snrpa	A	G	7: 27,192,946	V63A	possibly damaging	Het
Sphk1	A	G	11: 116,536,237	R340G	possibly damaging	Het
Strc	T	C	2: 121,370,946	E1259G	probably benign	Het
Suds3	T	G	5: 117,115,737	D26A	unknown	Het
Taok3	A	G	5: 117,250,907	E459G	probably damaging	Het
Unc13b	CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC	CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC	4: 43,177,312		probably benign	Het
Unc13b	AGCCAG	AGCCAGCGCCAG	4: 43,177,344		probably benign	Het
Vmn1r201	A	G	13: 22,474,819	T68A	not run	Het
Wdr59	T	A	8: 111,480,485	I534F		Het
Ylpm1	A	G	12: 85,015,022	I566V	unknown	Het
Zbtb4	A	G	11: 69,778,542	E697G	probably benign	Het
Zcchc14	T	C	8: 121,604,689	K645R	unknown	Het
Zfp704	C	T	3: 9,444,222	V388M	possibly damaging	Het
Zfp994	T	C	17: 22,200,847	T374A	possibly damaging	Het

Other mutations in Olfr229

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01069:Olfr229	APN	9	39910606	missense	possibly damaging	0.94
IGL01880:Olfr229	APN	9	39909941	missense	possibly damaging	0.95
IGL02142:Olfr229	APN	9	39910639	missense	possibly damaging	0.75
IGL02366:Olfr229	APN	9	39909992	missense	probably damaging	1.00
R0415:Olfr229	UTSW	9	39909983	missense	probably damaging	1.00
R1383:Olfr229	UTSW	9	39909864	missense	probably benign	0.10
R1838:Olfr229	UTSW	9	39909841	missense	possibly damaging	0.90
R3196:Olfr229	UTSW	9	39910460	missense	probably damaging	0.99
R3951:Olfr229	UTSW	9	39910725	missense	probably benign	0.40
R4984:Olfr229	UTSW	9	39910610	missense	probably benign	0.14
R5771:Olfr229	UTSW	9	39910250	missense	probably damaging	1.00
R7454:Olfr229	UTSW	9	39909904	missense	probably benign	0.02
R7756:Olfr229	UTSW	9	39910325	missense	possibly damaging	0.95
R7868:Olfr229	UTSW	9	39909986	missense	probably benign
R8670:Olfr229	UTSW	9	39910423	missense	probably benign	0.02
RF021:Olfr229	UTSW	9	39910045	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCGCAATTGCAGAGTGTCAC -3'
(R):5'- GTGCTAAAGGCTTTGGACCTG -3'

Sequencing Primer
(F):5'- CAATTGCAGAGTGTCACATGTTG -3'
(R):5'- TGCCCTCAGTGGAGCGAATAC -3'

Posted On

2019-11-26