Incidental Mutation 'R7758:Vmn1r201'
ID597692
Institutional Source Beutler Lab
Gene Symbol Vmn1r201
Ensembl Gene ENSMUSG00000094898
Gene Namevomeronasal 1 receptor 201
SynonymsV1ri4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R7758 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location22471923-22478701 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22474819 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 68 (T68A)
Ref Sequence ENSEMBL: ENSMUSP00000089324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091730]
Predicted Effect not run
Transcript: ENSMUST00000091730
AA Change: T68A
SMART Domains Protein: ENSMUSP00000089324
Gene: ENSMUSG00000094898
AA Change: T68A

DomainStartEndE-ValueType
Pfam:TAS2R 1 293 2.4e-9 PFAM
Pfam:V1R 35 299 1.1e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,128,167 D1124G probably damaging Het
Actr10 A G 12: 70,942,326 H73R probably damaging Het
Ak9 G T 10: 41,347,132 A424S Het
Alkbh5 G A 11: 60,539,077 V219M probably damaging Het
Ankrd60 T C 2: 173,568,769 *319W probably null Het
Bfar T C 16: 13,702,121 F406S possibly damaging Het
Brd4 A G 17: 32,198,982 I1157T unknown Het
Card6 G A 15: 5,099,896 Q673* probably null Het
Cdyl T A 13: 35,872,641 Y585N probably damaging Het
Cep192 A C 18: 67,856,313 I1844L possibly damaging Het
Colec11 A C 12: 28,595,242 probably null Het
Crh T A 3: 19,694,289 Y63F probably damaging Het
Dmbt1 C T 7: 131,121,197 H1946Y unknown Het
Dock4 C T 12: 40,710,879 T522I probably benign Het
Fstl4 C A 11: 53,168,296 D527E possibly damaging Het
Gm17019 A G 5: 15,029,286 *256Q probably null Het
Gm5460 A T 14: 34,035,157 T64S probably benign Het
Hist2h3b A G 3: 96,268,887 K65R possibly damaging Het
Hoxa9 A T 6: 52,225,562 N181K probably benign Het
Ift81 A T 5: 122,551,025 L676H probably damaging Het
Klhl35 C T 7: 99,473,218 T87I unknown Het
Kmt2e A G 5: 23,496,070 T761A possibly damaging Het
Lca5l C T 16: 96,178,837 R36H probably benign Het
Lin7c T A 2: 109,896,372 I122K probably damaging Het
Malt1 A G 18: 65,473,119 I622V probably benign Het
Megf8 T C 7: 25,342,425 probably null Het
Morc2b A G 17: 33,137,007 V597A probably damaging Het
Olfr1225 T A 2: 89,171,141 I24L probably benign Het
Olfr229 T G 9: 39,910,325 I174S possibly damaging Het
Olfr963 T C 9: 39,669,075 M6T probably benign Het
Pdlim1 G A 19: 40,243,542 P131S probably benign Het
Plekhh1 T C 12: 79,070,804 I858T probably benign Het
Pls1 T C 9: 95,776,844 N197S probably benign Het
Pnmal1 A T 7: 16,961,299 T360S probably benign Het
Pon1 A T 6: 5,168,344 D354E probably benign Het
Prss43 G A 9: 110,829,391 G253E possibly damaging Het
Rbp3 G A 14: 33,954,775 V227M probably benign Het
Slc22a15 A G 3: 101,897,935 probably null Het
Slc7a11 A G 3: 50,372,360 I484T probably benign Het
Snrpa A G 7: 27,192,946 V63A possibly damaging Het
Sphk1 A G 11: 116,536,237 R340G possibly damaging Het
Strc T C 2: 121,370,946 E1259G probably benign Het
Suds3 T G 5: 117,115,737 D26A unknown Het
Taok3 A G 5: 117,250,907 E459G probably damaging Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Unc13b AGCCAG AGCCAGCGCCAG 4: 43,177,344 probably benign Het
Wdr59 T A 8: 111,480,485 I534F Het
Ylpm1 A G 12: 85,015,022 I566V unknown Het
Zbtb4 A G 11: 69,778,542 E697G probably benign Het
Zcchc14 T C 8: 121,604,689 K645R unknown Het
Zfp704 C T 3: 9,444,222 V388M possibly damaging Het
Zfp994 T C 17: 22,200,847 T374A possibly damaging Het
Other mutations in Vmn1r201
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02792:Vmn1r201 APN 13 22474844 missense probably damaging 0.97
IGL03137:Vmn1r201 APN 13 22474804 missense probably benign 0.01
R0278:Vmn1r201 UTSW 13 22475024 missense probably damaging 1.00
R0381:Vmn1r201 UTSW 13 22475023 missense probably damaging 1.00
R0544:Vmn1r201 UTSW 13 22475146 missense probably benign 0.04
R1411:Vmn1r201 UTSW 13 22474679 missense probably benign 0.01
R1544:Vmn1r201 UTSW 13 22474798 missense probably benign 0.20
R1850:Vmn1r201 UTSW 13 22474631 missense probably benign 0.08
R1891:Vmn1r201 UTSW 13 22475255 missense probably benign 0.01
R2071:Vmn1r201 UTSW 13 22474825 missense probably benign 0.34
R4183:Vmn1r201 UTSW 13 22474852 missense probably benign 0.01
R4924:Vmn1r201 UTSW 13 22474712 missense probably benign 0.00
R4989:Vmn1r201 UTSW 13 22475452 missense possibly damaging 0.95
R5028:Vmn1r201 UTSW 13 22475360 nonsense probably null
R5318:Vmn1r201 UTSW 13 22474922 missense probably damaging 1.00
R5369:Vmn1r201 UTSW 13 22475502 missense probably benign 0.00
R5682:Vmn1r201 UTSW 13 22475185 missense probably damaging 0.99
R5699:Vmn1r201 UTSW 13 22475239 missense probably damaging 1.00
R6180:Vmn1r201 UTSW 13 22475329 missense possibly damaging 0.94
R6273:Vmn1r201 UTSW 13 22475215 missense probably damaging 1.00
R6295:Vmn1r201 UTSW 13 22475363 missense probably benign 0.00
R6331:Vmn1r201 UTSW 13 22475351 missense probably damaging 1.00
R7296:Vmn1r201 UTSW 13 22475339 missense possibly damaging 0.69
R7832:Vmn1r201 UTSW 13 22475368 missense possibly damaging 0.76
R7887:Vmn1r201 UTSW 13 22474786 missense probably damaging 0.99
R7915:Vmn1r201 UTSW 13 22475368 missense possibly damaging 0.76
R7970:Vmn1r201 UTSW 13 22474786 missense probably damaging 0.99
Predicted Primers
Posted On2019-11-26