Incidental Mutation 'R7758:Morc2b'
ID597701
Institutional Source Beutler Lab
Gene Symbol Morc2b
Ensembl Gene ENSMUSG00000048602
Gene Namemicrorchidia 2B
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R7758 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location33135588-33139683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33137007 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 597 (V597A)
Ref Sequence ENSEMBL: ENSMUSP00000056879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053896] [ENSMUST00000131954]
Predicted Effect probably damaging
Transcript: ENSMUST00000053896
AA Change: V597A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056879
Gene: ENSMUSG00000048602
AA Change: V597A

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 495 541 1.9e-16 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131954
AA Change: V597A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123354
Gene: ENSMUSG00000048602
AA Change: V597A

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 494 543 7.7e-18 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (48/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with failure of chromosomal synapsis, double strand break repair, and recombination in meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,128,167 D1124G probably damaging Het
Actr10 A G 12: 70,942,326 H73R probably damaging Het
Ak9 G T 10: 41,347,132 A424S Het
Alkbh5 G A 11: 60,539,077 V219M probably damaging Het
Ankrd60 T C 2: 173,568,769 *319W probably null Het
Bfar T C 16: 13,702,121 F406S possibly damaging Het
Brd4 A G 17: 32,198,982 I1157T unknown Het
Card6 G A 15: 5,099,896 Q673* probably null Het
Cdyl T A 13: 35,872,641 Y585N probably damaging Het
Cep192 A C 18: 67,856,313 I1844L possibly damaging Het
Colec11 A C 12: 28,595,242 probably null Het
Crh T A 3: 19,694,289 Y63F probably damaging Het
Dmbt1 C T 7: 131,121,197 H1946Y unknown Het
Dock4 C T 12: 40,710,879 T522I probably benign Het
Fstl4 C A 11: 53,168,296 D527E possibly damaging Het
Gm17019 A G 5: 15,029,286 *256Q probably null Het
Gm5460 A T 14: 34,035,157 T64S probably benign Het
Hist2h3b A G 3: 96,268,887 K65R possibly damaging Het
Hoxa9 A T 6: 52,225,562 N181K probably benign Het
Ift81 A T 5: 122,551,025 L676H probably damaging Het
Klhl35 C T 7: 99,473,218 T87I unknown Het
Kmt2e A G 5: 23,496,070 T761A possibly damaging Het
Lca5l C T 16: 96,178,837 R36H probably benign Het
Lin7c T A 2: 109,896,372 I122K probably damaging Het
Malt1 A G 18: 65,473,119 I622V probably benign Het
Megf8 T C 7: 25,342,425 probably null Het
Olfr1225 T A 2: 89,171,141 I24L probably benign Het
Olfr229 T G 9: 39,910,325 I174S possibly damaging Het
Olfr963 T C 9: 39,669,075 M6T probably benign Het
Pdlim1 G A 19: 40,243,542 P131S probably benign Het
Plekhh1 T C 12: 79,070,804 I858T probably benign Het
Pls1 T C 9: 95,776,844 N197S probably benign Het
Pnmal1 A T 7: 16,961,299 T360S probably benign Het
Pon1 A T 6: 5,168,344 D354E probably benign Het
Prss43 G A 9: 110,829,391 G253E possibly damaging Het
Rbp3 G A 14: 33,954,775 V227M probably benign Het
Slc22a15 A G 3: 101,897,935 probably null Het
Slc7a11 A G 3: 50,372,360 I484T probably benign Het
Snrpa A G 7: 27,192,946 V63A possibly damaging Het
Sphk1 A G 11: 116,536,237 R340G possibly damaging Het
Strc T C 2: 121,370,946 E1259G probably benign Het
Suds3 T G 5: 117,115,737 D26A unknown Het
Taok3 A G 5: 117,250,907 E459G probably damaging Het
Unc13b CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,312 probably benign Het
Unc13b AGCCAG AGCCAGCGCCAG 4: 43,177,344 probably benign Het
Vmn1r201 A G 13: 22,474,819 T68A not run Het
Wdr59 T A 8: 111,480,485 I534F Het
Ylpm1 A G 12: 85,015,022 I566V unknown Het
Zbtb4 A G 11: 69,778,542 E697G probably benign Het
Zcchc14 T C 8: 121,604,689 K645R unknown Het
Zfp704 C T 3: 9,444,222 V388M possibly damaging Het
Zfp994 T C 17: 22,200,847 T374A possibly damaging Het
Other mutations in Morc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Morc2b APN 17 33137319 missense possibly damaging 0.47
IGL01369:Morc2b APN 17 33138165 missense probably benign 0.12
IGL01533:Morc2b APN 17 33135721 utr 3 prime probably benign
IGL02003:Morc2b APN 17 33138324 missense probably benign 0.07
IGL02028:Morc2b APN 17 33137413 missense possibly damaging 0.78
IGL02152:Morc2b APN 17 33137943 missense probably damaging 1.00
IGL02341:Morc2b APN 17 33137307 missense probably damaging 1.00
IGL02976:Morc2b APN 17 33137523 missense possibly damaging 0.90
IGL03293:Morc2b APN 17 33138363 missense probably damaging 1.00
PIT4283001:Morc2b UTSW 17 33136068 missense probably benign 0.00
R0056:Morc2b UTSW 17 33138759 missense possibly damaging 0.78
R0116:Morc2b UTSW 17 33137041 missense probably damaging 1.00
R0179:Morc2b UTSW 17 33136982 nonsense probably null
R0533:Morc2b UTSW 17 33135932 nonsense probably null
R0556:Morc2b UTSW 17 33137838 missense probably benign 0.05
R0629:Morc2b UTSW 17 33135807 missense probably benign 0.00
R0635:Morc2b UTSW 17 33137687 missense possibly damaging 0.90
R0840:Morc2b UTSW 17 33136112 missense probably benign 0.01
R1205:Morc2b UTSW 17 33135934 missense probably damaging 1.00
R1566:Morc2b UTSW 17 33136974 missense probably benign 0.02
R1676:Morc2b UTSW 17 33135981 missense possibly damaging 0.82
R1892:Morc2b UTSW 17 33135774 missense probably damaging 1.00
R1954:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1955:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1969:Morc2b UTSW 17 33137091 missense probably benign 0.00
R2069:Morc2b UTSW 17 33136760 missense probably benign 0.13
R3609:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3610:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3831:Morc2b UTSW 17 33137259 missense probably benign 0.01
R4156:Morc2b UTSW 17 33138427 missense probably benign 0.43
R4243:Morc2b UTSW 17 33136401 missense probably benign 0.03
R4877:Morc2b UTSW 17 33138738 missense probably benign 0.26
R4911:Morc2b UTSW 17 33137377 missense probably damaging 1.00
R5230:Morc2b UTSW 17 33136252 missense probably benign 0.00
R5264:Morc2b UTSW 17 33138379 missense probably benign 0.03
R5326:Morc2b UTSW 17 33136933 missense probably benign 0.01
R5455:Morc2b UTSW 17 33138610 missense probably benign 0.29
R5933:Morc2b UTSW 17 33138609 missense possibly damaging 0.84
R5973:Morc2b UTSW 17 33137472 missense probably damaging 0.97
R6026:Morc2b UTSW 17 33137983 missense possibly damaging 0.55
R6113:Morc2b UTSW 17 33138068 nonsense probably null
R6393:Morc2b UTSW 17 33137776 missense probably damaging 0.97
R7066:Morc2b UTSW 17 33136636 missense probably benign 0.00
R7117:Morc2b UTSW 17 33137952 missense probably benign 0.00
R7120:Morc2b UTSW 17 33135813 missense probably damaging 1.00
R7130:Morc2b UTSW 17 33136288 missense possibly damaging 0.68
R7498:Morc2b UTSW 17 33137859 missense possibly damaging 0.55
R7516:Morc2b UTSW 17 33137461 missense probably benign 0.03
R7664:Morc2b UTSW 17 33136402 missense probably benign 0.12
R7754:Morc2b UTSW 17 33137244 missense probably benign 0.33
R7756:Morc2b UTSW 17 33137007 missense probably damaging 1.00
R7766:Morc2b UTSW 17 33138423 missense probably benign 0.19
Z1088:Morc2b UTSW 17 33136086 missense possibly damaging 0.49
Z1177:Morc2b UTSW 17 33137402 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCTCACTGACTTTTGGG -3'
(R):5'- CTGAAGCAGAAGATTCCTCTGGG -3'

Sequencing Primer
(F):5'- GCCTCTGTTTTGTCTACCAGAAAAGG -3'
(R):5'- AAGCTTAAGGCCCTCAAG -3'
Posted On2019-11-26