Incidental Mutation 'R7759:Uggt1'
ID 597706
Institutional Source Beutler Lab
Gene Symbol Uggt1
Ensembl Gene ENSMUSG00000037470
Gene Name UDP-glucose glycoprotein glucosyltransferase 1
Synonyms Ugcgl1, C820010P03Rik, A930007H10Rik, 0910001L17Rik
MMRRC Submission 045815-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.491) question?
Stock # R7759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 36140027-36244720 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36146725 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1459 (M1459K)
Ref Sequence ENSEMBL: ENSMUSP00000037930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046875] [ENSMUST00000174266]
AlphaFold Q6P5E4
Predicted Effect possibly damaging
Transcript: ENSMUST00000046875
AA Change: M1459K

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037930
Gene: ENSMUSG00000037470
AA Change: M1459K

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:UDP-g_GGTase 44 1222 N/A PFAM
SCOP:d1ga8a_ 1256 1521 3e-45 SMART
Blast:BROMO 1414 1453 3e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174266
SMART Domains Protein: ENSMUSP00000134640
Gene: ENSMUSG00000037470

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
PHENOTYPE: Heterozygous KO reduces susceptibility to and morbidity of RNA virus infection. Homozygous KO is embryonic lethal. The peptide is a folding sensor for glycoproteins in the ER. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G T 16: 4,864,650 G215V probably benign Het
Adamts1 C A 16: 85,797,795 G652C probably damaging Het
Adck1 G A 12: 88,402,117 A122T possibly damaging Het
Akap1 A C 11: 88,845,833 M34R probably damaging Het
Apc2 C T 10: 80,311,196 R695C probably damaging Het
Apon T A 10: 128,254,515 W21R probably benign Het
Arhgef16 T C 4: 154,286,975 T254A probably benign Het
Arid5b T A 10: 68,097,802 S757C probably damaging Het
B020004C17Rik A C 14: 57,016,785 I122L possibly damaging Het
Bckdhb T G 9: 84,010,326 V270G probably damaging Het
Cacna1d A G 14: 30,099,188 Y1146H probably benign Het
Carmil2 A G 8: 105,697,036 D1214G possibly damaging Het
Ccdc142 T C 6: 83,107,931 V636A probably benign Het
Chd9 T C 8: 90,977,550 probably null Het
Csmd3 A G 15: 47,698,173 S1336P Het
Cubn A G 2: 13,348,150 Y1926H probably damaging Het
Ddx58 C A 4: 40,225,104 A298S probably damaging Het
Dock4 A T 12: 40,817,736 D1437V probably damaging Het
Eme1 A T 11: 94,645,840 Y504* probably null Het
Enah G A 1: 181,918,444 A687V unknown Het
Endou A C 15: 97,713,866 V339G probably damaging Het
Ephb6 G A 6: 41,614,605 R232H probably benign Het
Ephx2 G A 14: 66,089,519 A409V possibly damaging Het
Esd T A 14: 74,745,567 C219* probably null Het
Fscb A T 12: 64,474,092 M200K probably benign Het
Gabra6 A T 11: 42,317,681 V108D probably damaging Het
Gm11555 A G 11: 99,649,742 V137A unknown Het
Gpld1 A G 13: 24,962,400 D209G probably damaging Het
Ikzf1 T A 11: 11,769,256 I408N probably damaging Het
Itgb4 A G 11: 116,003,710 R1364G possibly damaging Het
Kif26b A C 1: 178,678,944 K195T probably damaging Het
Mfsd12 T C 10: 81,363,593 W440R probably benign Het
Mtrr C T 13: 68,570,027 E373K probably damaging Het
Mug2 T A 6: 122,081,358 V1293E probably damaging Het
Myof C A 19: 37,939,898 A1068S probably benign Het
Ncam2 A G 16: 81,615,784 D720G probably damaging Het
Nova2 G T 7: 18,958,251 G435V Het
Oacyl T A 18: 65,710,560 D109E probably damaging Het
Olfr1393 A T 11: 49,280,636 M163L probably benign Het
Olfr684 G A 7: 105,157,025 S219F probably damaging Het
Pdcd11 G A 19: 47,113,198 V941M possibly damaging Het
Pdzd8 C A 19: 59,299,926 R1014L probably damaging Het
Ppm1h T G 10: 122,904,113 D364E probably benign Het
Rp1 T C 1: 4,344,884 N2002D probably benign Het
Sall1 C T 8: 89,042,351 probably null Het
Scn10a C T 9: 119,648,132 W728* probably null Het
Setdb2 G T 14: 59,419,364 T168K probably damaging Het
Sgms1 T C 19: 32,159,876 I97V probably benign Het
Slc8a3 A T 12: 81,314,551 M498K probably benign Het
Smpd4 A T 16: 17,638,633 E362D probably damaging Het
Ssc5d A T 7: 4,937,530 K881* probably null Het
Strn4 A G 7: 16,830,384 E313G probably damaging Het
Tas2r113 A T 6: 132,893,927 N306I possibly damaging Het
Tdrd6 G T 17: 43,624,839 R1773S probably benign Het
Thbs2 T C 17: 14,677,059 E729G probably damaging Het
Tnfrsf23 G A 7: 143,670,835 T135I probably damaging Het
Tollip A G 7: 141,884,539 M218T probably benign Het
Tyk2 A T 9: 21,120,258 probably null Het
Ubr2 G A 17: 46,986,048 R269C probably damaging Het
Upf1 A G 8: 70,334,080 V929A probably benign Het
Usp48 T C 4: 137,594,452 S24P probably benign Het
Vmn1r214 G A 13: 23,034,461 E42K not run Het
Vmn1r83 G T 7: 12,321,433 D232E probably benign Het
Vmn2r25 C T 6: 123,823,380 V668I probably damaging Het
Vmn2r6 A G 3: 64,556,570 I281T probably damaging Het
Ywhag A T 5: 135,911,189 Y184N probably damaging Het
Zdbf2 A C 1: 63,308,376 E1971D possibly damaging Het
Zfp568 G A 7: 30,023,414 A595T possibly damaging Het
Zfy2 T C Y: 2,117,083 D248G probably benign Het
Other mutations in Uggt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Uggt1 APN 1 36179552 splice site probably benign
IGL00817:Uggt1 APN 1 36185932 missense probably benign 0.03
IGL01395:Uggt1 APN 1 36155077 missense probably damaging 1.00
IGL01609:Uggt1 APN 1 36182474 missense probably damaging 1.00
IGL01619:Uggt1 APN 1 36161694 missense probably damaging 0.99
IGL02077:Uggt1 APN 1 36176794 missense probably damaging 0.99
IGL02313:Uggt1 APN 1 36184484 missense probably damaging 0.99
IGL02341:Uggt1 APN 1 36164519 makesense probably null
IGL02346:Uggt1 APN 1 36179670 missense probably benign 0.00
IGL02447:Uggt1 APN 1 36150142 missense probably damaging 1.00
IGL02883:Uggt1 APN 1 36177615 missense probably benign 0.03
IGL02930:Uggt1 APN 1 36157456 missense probably benign 0.01
IGL03153:Uggt1 APN 1 36202818 missense possibly damaging 0.94
IGL03162:Uggt1 APN 1 36207956 missense probably damaging 1.00
IGL03170:Uggt1 APN 1 36163261 missense probably damaging 1.00
IGL03266:Uggt1 APN 1 36150048 missense probably damaging 1.00
K3955:Uggt1 UTSW 1 36162353 missense probably benign 0.37
R0037:Uggt1 UTSW 1 36185932 missense probably benign 0.03
R0037:Uggt1 UTSW 1 36185932 missense probably benign 0.03
R0167:Uggt1 UTSW 1 36170197 critical splice donor site probably null
R0373:Uggt1 UTSW 1 36179670 missense probably benign 0.00
R0502:Uggt1 UTSW 1 36159946 missense probably damaging 1.00
R0546:Uggt1 UTSW 1 36195971 missense probably benign 0.00
R0610:Uggt1 UTSW 1 36165506 splice site probably benign
R0671:Uggt1 UTSW 1 36155128 missense probably damaging 1.00
R0760:Uggt1 UTSW 1 36161724 missense possibly damaging 0.68
R0825:Uggt1 UTSW 1 36158143 missense probably benign 0.01
R0827:Uggt1 UTSW 1 36156313 critical splice acceptor site probably null
R0884:Uggt1 UTSW 1 36175078 missense probably benign 0.00
R1112:Uggt1 UTSW 1 36173546 missense possibly damaging 0.54
R1470:Uggt1 UTSW 1 36176796 missense probably benign 0.13
R1470:Uggt1 UTSW 1 36176796 missense probably benign 0.13
R1592:Uggt1 UTSW 1 36202858 missense probably benign 0.04
R1730:Uggt1 UTSW 1 36221261 missense probably benign 0.05
R1923:Uggt1 UTSW 1 36179613 missense probably damaging 0.99
R1970:Uggt1 UTSW 1 36151781 missense probably damaging 1.00
R2086:Uggt1 UTSW 1 36192414 missense probably null 1.00
R2829:Uggt1 UTSW 1 36162294 missense probably benign 0.38
R3431:Uggt1 UTSW 1 36210059 nonsense probably null
R3432:Uggt1 UTSW 1 36210059 nonsense probably null
R3725:Uggt1 UTSW 1 36182507 nonsense probably null
R3880:Uggt1 UTSW 1 36176804 intron probably benign
R4052:Uggt1 UTSW 1 36164489 missense probably damaging 0.98
R4133:Uggt1 UTSW 1 36158159 missense probably damaging 1.00
R4489:Uggt1 UTSW 1 36146668 nonsense probably null
R4570:Uggt1 UTSW 1 36150073 missense probably damaging 1.00
R4866:Uggt1 UTSW 1 36202855 nonsense probably null
R4895:Uggt1 UTSW 1 36156264 missense probably damaging 1.00
R4900:Uggt1 UTSW 1 36202855 nonsense probably null
R5372:Uggt1 UTSW 1 36244060 splice site probably benign
R5385:Uggt1 UTSW 1 36184412 missense probably damaging 1.00
R5652:Uggt1 UTSW 1 36216153 nonsense probably null
R5694:Uggt1 UTSW 1 36179656 missense probably damaging 1.00
R5732:Uggt1 UTSW 1 36161771 splice site probably null
R5893:Uggt1 UTSW 1 36227628 splice site probably null
R6191:Uggt1 UTSW 1 36162208 missense probably damaging 0.98
R6247:Uggt1 UTSW 1 36163228 missense probably damaging 1.00
R6259:Uggt1 UTSW 1 36234916 missense probably benign 0.00
R6399:Uggt1 UTSW 1 36163366 missense possibly damaging 0.90
R6439:Uggt1 UTSW 1 36174951 missense possibly damaging 0.95
R6468:Uggt1 UTSW 1 36173450 missense probably benign 0.00
R6788:Uggt1 UTSW 1 36230688 missense probably benign 0.00
R7165:Uggt1 UTSW 1 36155107 missense probably benign 0.41
R7255:Uggt1 UTSW 1 36146106 missense probably damaging 1.00
R7273:Uggt1 UTSW 1 36162221 missense probably damaging 0.99
R7469:Uggt1 UTSW 1 36151733 missense probably damaging 1.00
R7490:Uggt1 UTSW 1 36164508 missense probably benign 0.01
R7570:Uggt1 UTSW 1 36185838 missense probably benign 0.09
R7612:Uggt1 UTSW 1 36163235 missense probably damaging 0.99
R7792:Uggt1 UTSW 1 36207984 missense probably damaging 1.00
R7816:Uggt1 UTSW 1 36163315 missense possibly damaging 0.95
R7858:Uggt1 UTSW 1 36156258 missense probably damaging 1.00
R7887:Uggt1 UTSW 1 36208034 missense probably damaging 0.99
R8040:Uggt1 UTSW 1 36211473 missense possibly damaging 0.70
R8093:Uggt1 UTSW 1 36227485 missense probably damaging 1.00
R8245:Uggt1 UTSW 1 36165564 missense probably damaging 1.00
R8338:Uggt1 UTSW 1 36227521 missense probably damaging 1.00
R8353:Uggt1 UTSW 1 36170296 critical splice acceptor site probably null
R8442:Uggt1 UTSW 1 36173487 missense probably damaging 0.99
R8519:Uggt1 UTSW 1 36176643 splice site probably null
R8529:Uggt1 UTSW 1 36184432 missense possibly damaging 0.85
R8730:Uggt1 UTSW 1 36197543 critical splice donor site probably null
R8917:Uggt1 UTSW 1 36146654 missense
R8947:Uggt1 UTSW 1 36158148 missense probably benign 0.12
R9240:Uggt1 UTSW 1 36182615 missense possibly damaging 0.50
R9248:Uggt1 UTSW 1 36210022 missense possibly damaging 0.80
R9401:Uggt1 UTSW 1 36216131 critical splice donor site probably null
R9414:Uggt1 UTSW 1 36184426 missense probably benign 0.01
R9416:Uggt1 UTSW 1 36164522 missense
R9441:Uggt1 UTSW 1 36221225 missense probably benign 0.02
R9489:Uggt1 UTSW 1 36234805 critical splice donor site probably null
R9563:Uggt1 UTSW 1 36165546 missense possibly damaging 0.60
R9605:Uggt1 UTSW 1 36234805 critical splice donor site probably null
X0022:Uggt1 UTSW 1 36165555 missense possibly damaging 0.67
Z1088:Uggt1 UTSW 1 36174191 missense probably damaging 1.00
Z1176:Uggt1 UTSW 1 36161695 missense probably damaging 1.00
Z1177:Uggt1 UTSW 1 36155073 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGGTTCTCTGTCCCAGG -3'
(R):5'- TGCAGTGAAATGTAGTTGAATCTTG -3'

Sequencing Primer
(F):5'- TTCTCTGTCCCAGGGCAGG -3'
(R):5'- TCCCTGTAAGAGGTGCTAATGCC -3'
Posted On 2019-11-26