Incidental Mutation 'R7759:Kif26b'
ID 597708
Institutional Source Beutler Lab
Gene Symbol Kif26b
Ensembl Gene ENSMUSG00000026494
Gene Name kinesin family member 26B
Synonyms D230039L06Rik, N-11 kinesin
MMRRC Submission 045815-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 178356690-178766765 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 178506509 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Threonine at position 195 (K195T)
Ref Sequence ENSEMBL: ENSMUSP00000124462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161017]
AlphaFold Q7TNC6
Predicted Effect probably damaging
Transcript: ENSMUST00000161017
AA Change: K195T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124462
Gene: ENSMUSG00000026494
AA Change: K195T

DomainStartEndE-ValueType
low complexity region 58 123 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 220 228 N/A INTRINSIC
Blast:KISc 365 446 4e-8 BLAST
KISc 448 809 2.48e-42 SMART
low complexity region 810 822 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 907 913 N/A INTRINSIC
low complexity region 1007 1047 N/A INTRINSIC
low complexity region 1099 1109 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
low complexity region 1741 1769 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with impaired kidney development due to loss of cortical nephrogenic zone mesenchyme and failure of ureteric buds to invade and branch into the mesenchyme. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G T 16: 4,682,514 (GRCm39) G215V probably benign Het
Adamts1 C A 16: 85,594,683 (GRCm39) G652C probably damaging Het
Adck1 G A 12: 88,368,887 (GRCm39) A122T possibly damaging Het
Akap1 A C 11: 88,736,659 (GRCm39) M34R probably damaging Het
Apc2 C T 10: 80,147,030 (GRCm39) R695C probably damaging Het
Apon T A 10: 128,090,384 (GRCm39) W21R probably benign Het
Arhgef16 T C 4: 154,371,432 (GRCm39) T254A probably benign Het
Arid5b T A 10: 67,933,632 (GRCm39) S757C probably damaging Het
B020004C17Rik A C 14: 57,254,242 (GRCm39) I122L possibly damaging Het
Bckdhb T G 9: 83,892,379 (GRCm39) V270G probably damaging Het
Cacna1d A G 14: 29,821,145 (GRCm39) Y1146H probably benign Het
Carmil2 A G 8: 106,423,668 (GRCm39) D1214G possibly damaging Het
Ccdc142 T C 6: 83,084,912 (GRCm39) V636A probably benign Het
Chd9 T C 8: 91,704,178 (GRCm39) probably null Het
Csmd3 A G 15: 47,561,569 (GRCm39) S1336P Het
Cubn A G 2: 13,352,961 (GRCm39) Y1926H probably damaging Het
Dock4 A T 12: 40,867,735 (GRCm39) D1437V probably damaging Het
Eme1 A T 11: 94,536,666 (GRCm39) Y504* probably null Het
Enah G A 1: 181,746,009 (GRCm39) A687V unknown Het
Endou A C 15: 97,611,747 (GRCm39) V339G probably damaging Het
Ephb6 G A 6: 41,591,539 (GRCm39) R232H probably benign Het
Ephx2 G A 14: 66,326,968 (GRCm39) A409V possibly damaging Het
Esd T A 14: 74,983,007 (GRCm39) C219* probably null Het
Fscb A T 12: 64,520,866 (GRCm39) M200K probably benign Het
Gabra6 A T 11: 42,208,508 (GRCm39) V108D probably damaging Het
Gm11555 A G 11: 99,540,568 (GRCm39) V137A unknown Het
Gpld1 A G 13: 25,146,383 (GRCm39) D209G probably damaging Het
Ikzf1 T A 11: 11,719,256 (GRCm39) I408N probably damaging Het
Itgb4 A G 11: 115,894,536 (GRCm39) R1364G possibly damaging Het
Mfsd12 T C 10: 81,199,427 (GRCm39) W440R probably benign Het
Mtrr C T 13: 68,718,146 (GRCm39) E373K probably damaging Het
Mug2 T A 6: 122,058,317 (GRCm39) V1293E probably damaging Het
Myof C A 19: 37,928,346 (GRCm39) A1068S probably benign Het
Ncam2 A G 16: 81,412,672 (GRCm39) D720G probably damaging Het
Nova2 G T 7: 18,692,176 (GRCm39) G435V Het
Oacyl T A 18: 65,843,631 (GRCm39) D109E probably damaging Het
Or2y1g A T 11: 49,171,463 (GRCm39) M163L probably benign Het
Or56a4 G A 7: 104,806,232 (GRCm39) S219F probably damaging Het
Pdcd11 G A 19: 47,101,637 (GRCm39) V941M possibly damaging Het
Pdzd8 C A 19: 59,288,358 (GRCm39) R1014L probably damaging Het
Ppm1h T G 10: 122,740,018 (GRCm39) D364E probably benign Het
Rigi C A 4: 40,225,104 (GRCm39) A298S probably damaging Het
Rp1 T C 1: 4,415,107 (GRCm39) N2002D probably benign Het
Sall1 C T 8: 89,768,979 (GRCm39) probably null Het
Scn10a C T 9: 119,477,198 (GRCm39) W728* probably null Het
Setdb2 G T 14: 59,656,813 (GRCm39) T168K probably damaging Het
Sgms1 T C 19: 32,137,276 (GRCm39) I97V probably benign Het
Slc8a3 A T 12: 81,361,325 (GRCm39) M498K probably benign Het
Smpd4 A T 16: 17,456,497 (GRCm39) E362D probably damaging Het
Ssc5d A T 7: 4,940,529 (GRCm39) K881* probably null Het
Strn4 A G 7: 16,564,309 (GRCm39) E313G probably damaging Het
Tas2r113 A T 6: 132,870,890 (GRCm39) N306I possibly damaging Het
Tdrd6 G T 17: 43,935,730 (GRCm39) R1773S probably benign Het
Thbs2 T C 17: 14,897,321 (GRCm39) E729G probably damaging Het
Tnfrsf23 G A 7: 143,224,572 (GRCm39) T135I probably damaging Het
Tollip A G 7: 141,438,276 (GRCm39) M218T probably benign Het
Tyk2 A T 9: 21,031,554 (GRCm39) probably null Het
Ubr2 G A 17: 47,296,974 (GRCm39) R269C probably damaging Het
Uggt1 A T 1: 36,185,806 (GRCm39) M1459K possibly damaging Het
Upf1 A G 8: 70,786,730 (GRCm39) V929A probably benign Het
Usp48 T C 4: 137,321,763 (GRCm39) S24P probably benign Het
Vmn1r214 G A 13: 23,218,631 (GRCm39) E42K not run Het
Vmn1r83 G T 7: 12,055,360 (GRCm39) D232E probably benign Het
Vmn2r25 C T 6: 123,800,339 (GRCm39) V668I probably damaging Het
Vmn2r6 A G 3: 64,463,991 (GRCm39) I281T probably damaging Het
Ywhag A T 5: 135,940,043 (GRCm39) Y184N probably damaging Het
Zdbf2 A C 1: 63,347,535 (GRCm39) E1971D possibly damaging Het
Zfp568 G A 7: 29,722,839 (GRCm39) A595T possibly damaging Het
Zfy2 T C Y: 2,117,083 (GRCm39) D248G probably benign Het
Other mutations in Kif26b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kif26b APN 1 178,743,213 (GRCm39) missense probably damaging 1.00
IGL00425:Kif26b APN 1 178,743,866 (GRCm39) missense probably damaging 0.96
IGL00952:Kif26b APN 1 178,759,770 (GRCm39) missense probably damaging 1.00
IGL01100:Kif26b APN 1 178,744,809 (GRCm39) missense probably benign
IGL01347:Kif26b APN 1 178,698,240 (GRCm39) missense probably damaging 1.00
IGL01543:Kif26b APN 1 178,506,526 (GRCm39) missense probably benign 0.41
IGL01938:Kif26b APN 1 178,743,603 (GRCm39) missense probably damaging 0.99
IGL02100:Kif26b APN 1 178,743,512 (GRCm39) missense probably damaging 0.99
IGL02262:Kif26b APN 1 178,743,633 (GRCm39) missense probably benign 0.05
IGL02576:Kif26b APN 1 178,743,912 (GRCm39) missense probably benign
IGL02673:Kif26b APN 1 178,649,170 (GRCm39) missense probably damaging 1.00
IGL03078:Kif26b APN 1 178,698,291 (GRCm39) missense probably damaging 1.00
IGL03155:Kif26b APN 1 178,701,693 (GRCm39) missense probably damaging 1.00
IGL03157:Kif26b APN 1 178,743,930 (GRCm39) missense probably damaging 1.00
IGL03162:Kif26b APN 1 178,744,497 (GRCm39) missense probably benign
IGL03220:Kif26b APN 1 178,692,434 (GRCm39) missense probably damaging 1.00
IGL03299:Kif26b APN 1 178,649,125 (GRCm39) missense probably benign 0.09
IGL03368:Kif26b APN 1 178,743,773 (GRCm39) missense probably damaging 1.00
IGL03370:Kif26b APN 1 178,742,946 (GRCm39) missense probably benign 0.39
PIT4449001:Kif26b UTSW 1 178,745,651 (GRCm39) missense probably damaging 1.00
R0142:Kif26b UTSW 1 178,742,954 (GRCm39) missense probably damaging 1.00
R0621:Kif26b UTSW 1 178,743,218 (GRCm39) missense probably benign 0.02
R0987:Kif26b UTSW 1 178,649,185 (GRCm39) missense probably damaging 1.00
R1107:Kif26b UTSW 1 178,745,238 (GRCm39) missense probably benign 0.03
R1367:Kif26b UTSW 1 178,744,028 (GRCm39) missense probably damaging 1.00
R1386:Kif26b UTSW 1 178,743,209 (GRCm39) missense probably benign
R1619:Kif26b UTSW 1 178,744,043 (GRCm39) missense probably benign 0.00
R1664:Kif26b UTSW 1 178,759,704 (GRCm39) missense probably damaging 1.00
R2240:Kif26b UTSW 1 178,543,488 (GRCm39) missense probably benign 0.00
R2264:Kif26b UTSW 1 178,756,407 (GRCm39) critical splice acceptor site probably null
R2443:Kif26b UTSW 1 178,742,579 (GRCm39) missense probably damaging 0.99
R3023:Kif26b UTSW 1 178,692,433 (GRCm39) missense probably damaging 0.99
R3744:Kif26b UTSW 1 178,506,595 (GRCm39) missense probably benign 0.00
R3831:Kif26b UTSW 1 178,744,181 (GRCm39) frame shift probably null
R3832:Kif26b UTSW 1 178,744,181 (GRCm39) frame shift probably null
R3833:Kif26b UTSW 1 178,744,181 (GRCm39) frame shift probably null
R3843:Kif26b UTSW 1 178,755,742 (GRCm39) missense probably damaging 1.00
R4108:Kif26b UTSW 1 178,744,530 (GRCm39) missense possibly damaging 0.88
R4181:Kif26b UTSW 1 178,742,991 (GRCm39) missense probably damaging 0.98
R4551:Kif26b UTSW 1 178,711,600 (GRCm39) missense probably damaging 1.00
R4552:Kif26b UTSW 1 178,711,600 (GRCm39) missense probably damaging 1.00
R4597:Kif26b UTSW 1 178,744,358 (GRCm39) missense probably damaging 1.00
R4599:Kif26b UTSW 1 178,358,024 (GRCm39) missense unknown
R4610:Kif26b UTSW 1 178,506,920 (GRCm39) missense probably damaging 1.00
R4746:Kif26b UTSW 1 178,701,546 (GRCm39) nonsense probably null
R4873:Kif26b UTSW 1 178,742,892 (GRCm39) missense probably benign 0.38
R4875:Kif26b UTSW 1 178,742,892 (GRCm39) missense probably benign 0.38
R5015:Kif26b UTSW 1 178,755,895 (GRCm39) missense probably damaging 0.99
R5060:Kif26b UTSW 1 178,358,195 (GRCm39) missense unknown
R5301:Kif26b UTSW 1 178,358,233 (GRCm39) missense unknown
R5368:Kif26b UTSW 1 178,743,449 (GRCm39) missense probably damaging 1.00
R5387:Kif26b UTSW 1 178,742,441 (GRCm39) missense probably benign 0.01
R5589:Kif26b UTSW 1 178,743,864 (GRCm39) missense probably benign 0.05
R6150:Kif26b UTSW 1 178,743,111 (GRCm39) missense probably damaging 1.00
R6259:Kif26b UTSW 1 178,744,970 (GRCm39) missense probably damaging 0.97
R6355:Kif26b UTSW 1 178,743,743 (GRCm39) missense probably damaging 1.00
R6408:Kif26b UTSW 1 178,745,133 (GRCm39) missense probably damaging 1.00
R6488:Kif26b UTSW 1 178,357,138 (GRCm39) missense unknown
R6546:Kif26b UTSW 1 178,755,871 (GRCm39) missense probably damaging 1.00
R6702:Kif26b UTSW 1 178,744,852 (GRCm39) missense possibly damaging 0.90
R6886:Kif26b UTSW 1 178,701,703 (GRCm39) missense probably damaging 1.00
R6953:Kif26b UTSW 1 178,701,637 (GRCm39) missense possibly damaging 0.89
R7262:Kif26b UTSW 1 178,745,219 (GRCm39) missense possibly damaging 0.84
R7291:Kif26b UTSW 1 178,506,611 (GRCm39) missense possibly damaging 0.86
R7346:Kif26b UTSW 1 178,358,306 (GRCm39) missense probably damaging 1.00
R7383:Kif26b UTSW 1 178,358,275 (GRCm39) missense probably damaging 1.00
R7448:Kif26b UTSW 1 178,742,339 (GRCm39) missense probably damaging 1.00
R7506:Kif26b UTSW 1 178,357,064 (GRCm39) start gained probably benign
R7562:Kif26b UTSW 1 178,742,541 (GRCm39) missense probably damaging 1.00
R7583:Kif26b UTSW 1 178,358,010 (GRCm39) nonsense probably null
R7585:Kif26b UTSW 1 178,744,061 (GRCm39) missense probably benign 0.01
R7644:Kif26b UTSW 1 178,506,839 (GRCm39) missense probably benign 0.04
R7775:Kif26b UTSW 1 178,692,441 (GRCm39) missense probably benign 0.15
R7954:Kif26b UTSW 1 178,696,944 (GRCm39) missense probably damaging 0.99
R7960:Kif26b UTSW 1 178,506,484 (GRCm39) missense probably damaging 1.00
R8012:Kif26b UTSW 1 178,743,815 (GRCm39) missense probably benign 0.20
R8152:Kif26b UTSW 1 178,506,794 (GRCm39) missense possibly damaging 0.46
R8320:Kif26b UTSW 1 178,711,641 (GRCm39) critical splice donor site probably null
R8360:Kif26b UTSW 1 178,743,938 (GRCm39) missense probably benign 0.18
R8428:Kif26b UTSW 1 178,744,923 (GRCm39) missense probably benign 0.09
R8670:Kif26b UTSW 1 178,741,349 (GRCm39) missense probably damaging 1.00
R8737:Kif26b UTSW 1 178,692,430 (GRCm39) missense probably damaging 0.99
R8788:Kif26b UTSW 1 178,357,090 (GRCm39) start gained probably benign
R8854:Kif26b UTSW 1 178,743,948 (GRCm39) missense possibly damaging 0.93
R8870:Kif26b UTSW 1 178,692,594 (GRCm39) missense probably damaging 1.00
R8963:Kif26b UTSW 1 178,743,714 (GRCm39) missense probably benign 0.00
R9232:Kif26b UTSW 1 178,742,511 (GRCm39) missense probably damaging 1.00
R9297:Kif26b UTSW 1 178,543,374 (GRCm39) nonsense probably null
R9338:Kif26b UTSW 1 178,744,058 (GRCm39) missense probably damaging 1.00
R9572:Kif26b UTSW 1 178,745,042 (GRCm39) missense probably benign
R9580:Kif26b UTSW 1 178,506,643 (GRCm39) nonsense probably null
R9694:Kif26b UTSW 1 178,743,815 (GRCm39) missense probably benign 0.20
X0021:Kif26b UTSW 1 178,755,724 (GRCm39) missense probably damaging 1.00
X0024:Kif26b UTSW 1 178,506,647 (GRCm39) missense probably benign 0.14
X0025:Kif26b UTSW 1 178,742,948 (GRCm39) missense possibly damaging 0.70
X0025:Kif26b UTSW 1 178,742,831 (GRCm39) nonsense probably null
Z1177:Kif26b UTSW 1 178,742,970 (GRCm39) nonsense probably null
Z1177:Kif26b UTSW 1 178,649,115 (GRCm39) nonsense probably null
Z1177:Kif26b UTSW 1 178,649,113 (GRCm39) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AAATCCTTGGGTGGCAGACG -3'
(R):5'- CCTGTGTAGGTAGAAGTGGC -3'

Sequencing Primer
(F):5'- GCAGACGTCTGAACTGGATTTACC -3'
(R):5'- CCTGTGTAGGTAGAAGTGGCATAGG -3'
Posted On 2019-11-26