Mutagenetix > Incidental Mutation

Incidental Mutation 'R7759:Kif26b'

597708

Institutional Source

Beutler Lab

Gene Symbol

Kif26b

Ensembl Gene

ENSMUSG00000026494

Gene Name

kinesin family member 26B

Synonyms

D230039L06Rik, N-11 kinesin

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7759 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

178529125-178939200 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 178678944 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Threonine at position 195 (K195T)

Ref Sequence

ENSEMBL: ENSMUSP00000124462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000161017]

AlphaFold

Q7TNC6

Predicted Effect

probably damaging
Transcript: ENSMUST00000161017
AA Change: K195T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124462
Gene: ENSMUSG00000026494
AA Change: K195T

Domain	Start	End	E-Value	Type
low complexity region	58	123	N/A	INTRINSIC
low complexity region	144	155	N/A	INTRINSIC
low complexity region	220	228	N/A	INTRINSIC
Blast:KISc	365	446	4e-8	BLAST
KISc	448	809	2.48e-42	SMART
low complexity region	810	822	N/A	INTRINSIC
low complexity region	849	863	N/A	INTRINSIC
low complexity region	907	913	N/A	INTRINSIC
low complexity region	1007	1047	N/A	INTRINSIC
low complexity region	1099	1109	N/A	INTRINSIC
low complexity region	1269	1288	N/A	INTRINSIC
low complexity region	1485	1495	N/A	INTRINSIC
low complexity region	1741	1769	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with impaired kidney development due to loss of cortical nephrogenic zone mesenchyme and failure of ureteric buds to invade and branch into the mesenchyme. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	G	T	16: 4,864,650	G215V	probably benign	Het
Adamts1	C	A	16: 85,797,795	G652C	probably damaging	Het
Adck1	G	A	12: 88,402,117	A122T	possibly damaging	Het
Akap1	A	C	11: 88,845,833	M34R	probably damaging	Het
Apc2	C	T	10: 80,311,196	R695C	probably damaging	Het
Apon	T	A	10: 128,254,515	W21R	probably benign	Het
Arhgef16	T	C	4: 154,286,975	T254A	probably benign	Het
Arid5b	T	A	10: 68,097,802	S757C	probably damaging	Het
B020004C17Rik	A	C	14: 57,016,785	I122L	possibly damaging	Het
Bckdhb	T	G	9: 84,010,326	V270G	probably damaging	Het
Cacna1d	A	G	14: 30,099,188	Y1146H	probably benign	Het
Carmil2	A	G	8: 105,697,036	D1214G	possibly damaging	Het
Ccdc142	T	C	6: 83,107,931	V636A	probably benign	Het
Chd9	T	C	8: 90,977,550		probably null	Het
Csmd3	A	G	15: 47,698,173	S1336P		Het
Cubn	A	G	2: 13,348,150	Y1926H	probably damaging	Het
Ddx58	C	A	4: 40,225,104	A298S	probably damaging	Het
Dock4	A	T	12: 40,817,736	D1437V	probably damaging	Het
Eme1	A	T	11: 94,645,840	Y504*	probably null	Het
Enah	G	A	1: 181,918,444	A687V	unknown	Het
Endou	A	C	15: 97,713,866	V339G	probably damaging	Het
Ephb6	G	A	6: 41,614,605	R232H	probably benign	Het
Ephx2	G	A	14: 66,089,519	A409V	possibly damaging	Het
Esd	T	A	14: 74,745,567	C219*	probably null	Het
Fscb	A	T	12: 64,474,092	M200K	probably benign	Het
Gabra6	A	T	11: 42,317,681	V108D	probably damaging	Het
Gm11555	A	G	11: 99,649,742	V137A	unknown	Het
Gpld1	A	G	13: 24,962,400	D209G	probably damaging	Het
Ikzf1	T	A	11: 11,769,256	I408N	probably damaging	Het
Itgb4	A	G	11: 116,003,710	R1364G	possibly damaging	Het
Mfsd12	T	C	10: 81,363,593	W440R	probably benign	Het
Mtrr	C	T	13: 68,570,027	E373K	probably damaging	Het
Mug2	T	A	6: 122,081,358	V1293E	probably damaging	Het
Myof	C	A	19: 37,939,898	A1068S	probably benign	Het
Ncam2	A	G	16: 81,615,784	D720G	probably damaging	Het
Nova2	G	T	7: 18,958,251	G435V		Het
Oacyl	T	A	18: 65,710,560	D109E	probably damaging	Het
Olfr1393	A	T	11: 49,280,636	M163L	probably benign	Het
Olfr684	G	A	7: 105,157,025	S219F	probably damaging	Het
Pdcd11	G	A	19: 47,113,198	V941M	possibly damaging	Het
Pdzd8	C	A	19: 59,299,926	R1014L	probably damaging	Het
Ppm1h	T	G	10: 122,904,113	D364E	probably benign	Het
Rp1	T	C	1: 4,344,884	N2002D	probably benign	Het
Sall1	C	T	8: 89,042,351		probably null	Het
Scn10a	C	T	9: 119,648,132	W728*	probably null	Het
Setdb2	G	T	14: 59,419,364	T168K	probably damaging	Het
Sgms1	T	C	19: 32,159,876	I97V	probably benign	Het
Slc8a3	A	T	12: 81,314,551	M498K	probably benign	Het
Smpd4	A	T	16: 17,638,633	E362D	probably damaging	Het
Ssc5d	A	T	7: 4,937,530	K881*	probably null	Het
Strn4	A	G	7: 16,830,384	E313G	probably damaging	Het
Tas2r113	A	T	6: 132,893,927	N306I	possibly damaging	Het
Tdrd6	G	T	17: 43,624,839	R1773S	probably benign	Het
Thbs2	T	C	17: 14,677,059	E729G	probably damaging	Het
Tnfrsf23	G	A	7: 143,670,835	T135I	probably damaging	Het
Tollip	A	G	7: 141,884,539	M218T	probably benign	Het
Tyk2	A	T	9: 21,120,258		probably null	Het
Ubr2	G	A	17: 46,986,048	R269C	probably damaging	Het
Uggt1	A	T	1: 36,146,725	M1459K	possibly damaging	Het
Upf1	A	G	8: 70,334,080	V929A	probably benign	Het
Usp48	T	C	4: 137,594,452	S24P	probably benign	Het
Vmn1r214	G	A	13: 23,034,461	E42K	not run	Het
Vmn1r83	G	T	7: 12,321,433	D232E	probably benign	Het
Vmn2r25	C	T	6: 123,823,380	V668I	probably damaging	Het
Vmn2r6	A	G	3: 64,556,570	I281T	probably damaging	Het
Ywhag	A	T	5: 135,911,189	Y184N	probably damaging	Het
Zdbf2	A	C	1: 63,308,376	E1971D	possibly damaging	Het
Zfp568	G	A	7: 30,023,414	A595T	possibly damaging	Het
Zfy2	T	C	Y: 2,117,083	D248G	probably benign	Het

Other mutations in Kif26b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Kif26b	APN	1	178915648	missense	probably damaging	1.00
IGL00425:Kif26b	APN	1	178916301	missense	probably damaging	0.96
IGL00952:Kif26b	APN	1	178932205	missense	probably damaging	1.00
IGL01100:Kif26b	APN	1	178917244	missense	probably benign
IGL01347:Kif26b	APN	1	178870675	missense	probably damaging	1.00
IGL01543:Kif26b	APN	1	178678961	missense	probably benign	0.41
IGL01938:Kif26b	APN	1	178916038	missense	probably damaging	0.99
IGL02100:Kif26b	APN	1	178915947	missense	probably damaging	0.99
IGL02262:Kif26b	APN	1	178916068	missense	probably benign	0.05
IGL02576:Kif26b	APN	1	178916347	missense	probably benign
IGL02673:Kif26b	APN	1	178821605	missense	probably damaging	1.00
IGL03078:Kif26b	APN	1	178870726	missense	probably damaging	1.00
IGL03155:Kif26b	APN	1	178874128	missense	probably damaging	1.00
IGL03157:Kif26b	APN	1	178916365	missense	probably damaging	1.00
IGL03162:Kif26b	APN	1	178916932	missense	probably benign
IGL03220:Kif26b	APN	1	178864869	missense	probably damaging	1.00
IGL03299:Kif26b	APN	1	178821560	missense	probably benign	0.09
IGL03368:Kif26b	APN	1	178916208	missense	probably damaging	1.00
IGL03370:Kif26b	APN	1	178915381	missense	probably benign	0.39
PIT4449001:Kif26b	UTSW	1	178918086	missense	probably damaging	1.00
R0142:Kif26b	UTSW	1	178915389	missense	probably damaging	1.00
R0621:Kif26b	UTSW	1	178915653	missense	probably benign	0.02
R0987:Kif26b	UTSW	1	178821620	missense	probably damaging	1.00
R1107:Kif26b	UTSW	1	178917673	missense	probably benign	0.03
R1367:Kif26b	UTSW	1	178916463	missense	probably damaging	1.00
R1386:Kif26b	UTSW	1	178915644	missense	probably benign
R1619:Kif26b	UTSW	1	178916478	missense	probably benign	0.00
R1664:Kif26b	UTSW	1	178932139	missense	probably damaging	1.00
R2240:Kif26b	UTSW	1	178715923	missense	probably benign	0.00
R2264:Kif26b	UTSW	1	178928842	critical splice acceptor site	probably null
R2443:Kif26b	UTSW	1	178915014	missense	probably damaging	0.99
R3023:Kif26b	UTSW	1	178864868	missense	probably damaging	0.99
R3744:Kif26b	UTSW	1	178679030	missense	probably benign	0.00
R3831:Kif26b	UTSW	1	178916616	frame shift	probably null
R3832:Kif26b	UTSW	1	178916616	frame shift	probably null
R3833:Kif26b	UTSW	1	178916616	frame shift	probably null
R3843:Kif26b	UTSW	1	178928177	missense	probably damaging	1.00
R4108:Kif26b	UTSW	1	178916965	missense	possibly damaging	0.88
R4181:Kif26b	UTSW	1	178915426	missense	probably damaging	0.98
R4551:Kif26b	UTSW	1	178884035	missense	probably damaging	1.00
R4552:Kif26b	UTSW	1	178884035	missense	probably damaging	1.00
R4597:Kif26b	UTSW	1	178916793	missense	probably damaging	1.00
R4599:Kif26b	UTSW	1	178530459	missense	unknown
R4610:Kif26b	UTSW	1	178679355	missense	probably damaging	1.00
R4746:Kif26b	UTSW	1	178873981	nonsense	probably null
R4873:Kif26b	UTSW	1	178915327	missense	probably benign	0.38
R4875:Kif26b	UTSW	1	178915327	missense	probably benign	0.38
R5015:Kif26b	UTSW	1	178928330	missense	probably damaging	0.99
R5060:Kif26b	UTSW	1	178530630	missense	unknown
R5301:Kif26b	UTSW	1	178530668	missense	unknown
R5368:Kif26b	UTSW	1	178915884	missense	probably damaging	1.00
R5387:Kif26b	UTSW	1	178914876	missense	probably benign	0.01
R5589:Kif26b	UTSW	1	178916299	missense	probably benign	0.05
R6150:Kif26b	UTSW	1	178915546	missense	probably damaging	1.00
R6259:Kif26b	UTSW	1	178917405	missense	probably damaging	0.97
R6355:Kif26b	UTSW	1	178916178	missense	probably damaging	1.00
R6408:Kif26b	UTSW	1	178917568	missense	probably damaging	1.00
R6488:Kif26b	UTSW	1	178529573	missense	unknown
R6546:Kif26b	UTSW	1	178928306	missense	probably damaging	1.00
R6702:Kif26b	UTSW	1	178917287	missense	possibly damaging	0.90
R6886:Kif26b	UTSW	1	178874138	missense	probably damaging	1.00
R6953:Kif26b	UTSW	1	178874072	missense	possibly damaging	0.89
R7262:Kif26b	UTSW	1	178917654	missense	possibly damaging	0.84
R7291:Kif26b	UTSW	1	178679046	missense	possibly damaging	0.86
R7346:Kif26b	UTSW	1	178530741	missense	probably damaging	1.00
R7383:Kif26b	UTSW	1	178530710	missense	probably damaging	1.00
R7448:Kif26b	UTSW	1	178914774	missense	probably damaging	1.00
R7506:Kif26b	UTSW	1	178529499	start gained	probably benign
R7562:Kif26b	UTSW	1	178914976	missense	probably damaging	1.00
R7583:Kif26b	UTSW	1	178530445	nonsense	probably null
R7585:Kif26b	UTSW	1	178916496	missense	probably benign	0.01
R7644:Kif26b	UTSW	1	178679274	missense	probably benign	0.04
R7775:Kif26b	UTSW	1	178864876	missense	probably benign	0.15
R7954:Kif26b	UTSW	1	178869379	missense	probably damaging	0.99
R7960:Kif26b	UTSW	1	178678919	missense	probably damaging	1.00
R8012:Kif26b	UTSW	1	178916250	missense	probably benign	0.20
R8152:Kif26b	UTSW	1	178679229	missense	possibly damaging	0.46
R8320:Kif26b	UTSW	1	178884076	critical splice donor site	probably null
R8360:Kif26b	UTSW	1	178916373	missense	probably benign	0.18
R8428:Kif26b	UTSW	1	178917358	missense	probably benign	0.09
R8670:Kif26b	UTSW	1	178913784	missense	probably damaging	1.00
R8737:Kif26b	UTSW	1	178864865	missense	probably damaging	0.99
R8788:Kif26b	UTSW	1	178529525	start gained	probably benign
R8854:Kif26b	UTSW	1	178916383	missense	possibly damaging	0.93
R8870:Kif26b	UTSW	1	178865029	missense	probably damaging	1.00
R8963:Kif26b	UTSW	1	178916149	missense	probably benign	0.00
R9232:Kif26b	UTSW	1	178914946	missense	probably damaging	1.00
R9297:Kif26b	UTSW	1	178715809	nonsense	probably null
R9338:Kif26b	UTSW	1	178916493	missense	probably damaging	1.00
R9572:Kif26b	UTSW	1	178917477	missense	probably benign
R9580:Kif26b	UTSW	1	178679078	nonsense	probably null
R9694:Kif26b	UTSW	1	178916250	missense	probably benign	0.20
X0021:Kif26b	UTSW	1	178928159	missense	probably damaging	1.00
X0024:Kif26b	UTSW	1	178679082	missense	probably benign	0.14
X0025:Kif26b	UTSW	1	178915266	nonsense	probably null
X0025:Kif26b	UTSW	1	178915383	missense	possibly damaging	0.70
Z1177:Kif26b	UTSW	1	178821548	missense	probably benign	0.11
Z1177:Kif26b	UTSW	1	178821550	nonsense	probably null
Z1177:Kif26b	UTSW	1	178915405	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AAATCCTTGGGTGGCAGACG -3'
(R):5'- CCTGTGTAGGTAGAAGTGGC -3'

Sequencing Primer
(F):5'- GCAGACGTCTGAACTGGATTTACC -3'
(R):5'- CCTGTGTAGGTAGAAGTGGCATAGG -3'

Posted On

2019-11-26