Mutagenetix > Incidental Mutation

Incidental Mutation 'R7759:Usp48'

597713

Institutional Source

Beutler Lab

Gene Symbol

Usp48

Ensembl Gene

ENSMUSG00000043411

Gene Name

ubiquitin specific peptidase 48

Synonyms

Usp31, D330022K21Rik, 2810449C13Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R7759 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

137593755-137658537 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 137594452 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 24 (S24P)

Ref Sequence

ENSEMBL: ENSMUSP00000055016 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055131] [ENSMUST00000105838] [ENSMUST00000105839] [ENSMUST00000105840] [ENSMUST00000153100]

AlphaFold

Q3V0C5

Predicted Effect

probably benign
Transcript: ENSMUST00000055131
AA Change: S24P

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000055016
Gene: ENSMUSG00000043411
AA Change: S24P

Domain	Start	End	E-Value	Type
Pfam:UCH	88	417	6.9e-44	PFAM
Pfam:UCH_1	89	374	1e-22	PFAM
Blast:DUSP	479	555	5e-39	BLAST
coiled coil region	622	643	N/A	INTRINSIC
UBQ	954	1022	4.78e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105838

SMART Domains

Protein: ENSMUSP00000101464
Gene: ENSMUSG00000043411

Domain	Start	End	E-Value	Type
Blast:DUSP	1	30	3e-11	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000105839
AA Change: S24P

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000101465
Gene: ENSMUSG00000043411
AA Change: S24P

Domain	Start	End	E-Value	Type
Pfam:UCH	88	418	3.2e-47	PFAM
Pfam:UCH_1	89	374	1.1e-25	PFAM
Blast:DUSP	480	556	5e-40	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000105840
AA Change: S24P

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000101466
Gene: ENSMUSG00000043411
AA Change: S24P

Domain	Start	End	E-Value	Type
Pfam:UCH	88	418	6.4e-49	PFAM
Pfam:UCH_1	89	374	1.8e-27	PFAM
Blast:DUSP	480	556	4e-39	BLAST
coiled coil region	624	645	N/A	INTRINSIC
Blast:DUSP	743	824	2e-7	BLAST
UBQ	938	1006	4.78e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000153100
AA Change: S52P

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000123154
Gene: ENSMUSG00000043411
AA Change: S52P

Domain	Start	End	E-Value	Type
Blast:IG_like	74	129	7e-34	BLAST
PDB:4M5X\|B	111	158	1e-7	PDB

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing domains that associate it with the peptidase family C19, also known as family 2 of ubiquitin carboxyl-terminal hydrolases. Family members function as deubiquitinating enzymes, recognizing and hydrolyzing the peptide bond at the C-terminal glycine of ubiquitin. Enzymes in peptidase family C19 are involved in the processing of poly-ubiquitin precursors as well as that of ubiquitinated proteins. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	G	T	16: 4,864,650	G215V	probably benign	Het
Adamts1	C	A	16: 85,797,795	G652C	probably damaging	Het
Adck1	G	A	12: 88,402,117	A122T	possibly damaging	Het
Akap1	A	C	11: 88,845,833	M34R	probably damaging	Het
Apc2	C	T	10: 80,311,196	R695C	probably damaging	Het
Apon	T	A	10: 128,254,515	W21R	probably benign	Het
Arhgef16	T	C	4: 154,286,975	T254A	probably benign	Het
Arid5b	T	A	10: 68,097,802	S757C	probably damaging	Het
B020004C17Rik	A	C	14: 57,016,785	I122L	possibly damaging	Het
Bckdhb	T	G	9: 84,010,326	V270G	probably damaging	Het
Cacna1d	A	G	14: 30,099,188	Y1146H	probably benign	Het
Carmil2	A	G	8: 105,697,036	D1214G	possibly damaging	Het
Ccdc142	T	C	6: 83,107,931	V636A	probably benign	Het
Chd9	T	C	8: 90,977,550		probably null	Het
Csmd3	A	G	15: 47,698,173	S1336P		Het
Cubn	A	G	2: 13,348,150	Y1926H	probably damaging	Het
Ddx58	C	A	4: 40,225,104	A298S	probably damaging	Het
Dock4	A	T	12: 40,817,736	D1437V	probably damaging	Het
Eme1	A	T	11: 94,645,840	Y504*	probably null	Het
Enah	G	A	1: 181,918,444	A687V	unknown	Het
Endou	A	C	15: 97,713,866	V339G	probably damaging	Het
Ephb6	G	A	6: 41,614,605	R232H	probably benign	Het
Ephx2	G	A	14: 66,089,519	A409V	possibly damaging	Het
Esd	T	A	14: 74,745,567	C219*	probably null	Het
Fscb	A	T	12: 64,474,092	M200K	probably benign	Het
Gabra6	A	T	11: 42,317,681	V108D	probably damaging	Het
Gm11555	A	G	11: 99,649,742	V137A	unknown	Het
Gpld1	A	G	13: 24,962,400	D209G	probably damaging	Het
Ikzf1	T	A	11: 11,769,256	I408N	probably damaging	Het
Itgb4	A	G	11: 116,003,710	R1364G	possibly damaging	Het
Kif26b	A	C	1: 178,678,944	K195T	probably damaging	Het
Mfsd12	T	C	10: 81,363,593	W440R	probably benign	Het
Mtrr	C	T	13: 68,570,027	E373K	probably damaging	Het
Mug2	T	A	6: 122,081,358	V1293E	probably damaging	Het
Myof	C	A	19: 37,939,898	A1068S	probably benign	Het
Ncam2	A	G	16: 81,615,784	D720G	probably damaging	Het
Nova2	G	T	7: 18,958,251	G435V		Het
Oacyl	T	A	18: 65,710,560	D109E	probably damaging	Het
Olfr1393	A	T	11: 49,280,636	M163L	probably benign	Het
Olfr684	G	A	7: 105,157,025	S219F	probably damaging	Het
Pdcd11	G	A	19: 47,113,198	V941M	possibly damaging	Het
Pdzd8	C	A	19: 59,299,926	R1014L	probably damaging	Het
Ppm1h	T	G	10: 122,904,113	D364E	probably benign	Het
Rp1	T	C	1: 4,344,884	N2002D	probably benign	Het
Sall1	C	T	8: 89,042,351		probably null	Het
Scn10a	C	T	9: 119,648,132	W728*	probably null	Het
Setdb2	G	T	14: 59,419,364	T168K	probably damaging	Het
Sgms1	T	C	19: 32,159,876	I97V	probably benign	Het
Slc8a3	A	T	12: 81,314,551	M498K	probably benign	Het
Smpd4	A	T	16: 17,638,633	E362D	probably damaging	Het
Ssc5d	A	T	7: 4,937,530	K881*	probably null	Het
Strn4	A	G	7: 16,830,384	E313G	probably damaging	Het
Tas2r113	A	T	6: 132,893,927	N306I	possibly damaging	Het
Tdrd6	G	T	17: 43,624,839	R1773S	probably benign	Het
Thbs2	T	C	17: 14,677,059	E729G	probably damaging	Het
Tnfrsf23	G	A	7: 143,670,835	T135I	probably damaging	Het
Tollip	A	G	7: 141,884,539	M218T	probably benign	Het
Tyk2	A	T	9: 21,120,258		probably null	Het
Ubr2	G	A	17: 46,986,048	R269C	probably damaging	Het
Uggt1	A	T	1: 36,146,725	M1459K	possibly damaging	Het
Upf1	A	G	8: 70,334,080	V929A	probably benign	Het
Vmn1r214	G	A	13: 23,034,461	E42K	not run	Het
Vmn1r83	G	T	7: 12,321,433	D232E	probably benign	Het
Vmn2r25	C	T	6: 123,823,380	V668I	probably damaging	Het
Vmn2r6	A	G	3: 64,556,570	I281T	probably damaging	Het
Ywhag	A	T	5: 135,911,189	Y184N	probably damaging	Het
Zdbf2	A	C	1: 63,308,376	E1971D	possibly damaging	Het
Zfp568	G	A	7: 30,023,414	A595T	possibly damaging	Het
Zfy2	T	C	Y: 2,117,083	D248G	probably benign	Het

Other mutations in Usp48

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01691:Usp48	APN	4	137623272	critical splice acceptor site	probably null
IGL01864:Usp48	APN	4	137639227	missense	possibly damaging	0.87
IGL02386:Usp48	APN	4	137604523	missense	possibly damaging	0.93
IGL03112:Usp48	APN	4	137608064	missense	probably damaging	1.00
IGL03114:Usp48	APN	4	137656125	missense	probably damaging	1.00
IGL03406:Usp48	APN	4	137639295	missense	possibly damaging	0.90
balfour	UTSW	4	137633455	missense	probably benign	0.00
burlap	UTSW	4	137625276	missense	possibly damaging	0.77
fulfillment	UTSW	4	137638233	missense	probably damaging	1.00
hayao	UTSW	4	137633439	nonsense	probably null
Mei	UTSW	4	137606693	nonsense	probably null
miyazaki	UTSW	4	137608154	missense	probably damaging	1.00
promise	UTSW	4	137634921	missense	probably damaging	1.00
satsuki	UTSW	4	137633126	missense	possibly damaging	0.93
Totoro	UTSW	4	137594483	missense	probably damaging	0.99
IGL02796:Usp48	UTSW	4	137610718	missense	probably damaging	1.00
R0050:Usp48	UTSW	4	137613803	missense	probably damaging	1.00
R0333:Usp48	UTSW	4	137594483	missense	probably damaging	0.99
R0382:Usp48	UTSW	4	137621218	missense	probably benign	0.00
R0423:Usp48	UTSW	4	137616411	missense	probably benign
R0570:Usp48	UTSW	4	137633126	missense	possibly damaging	0.93
R0855:Usp48	UTSW	4	137608154	missense	probably damaging	1.00
R0943:Usp48	UTSW	4	137644470	missense	possibly damaging	0.92
R1367:Usp48	UTSW	4	137639295	missense	possibly damaging	0.90
R1367:Usp48	UTSW	4	137644463	missense	probably damaging	1.00
R1689:Usp48	UTSW	4	137656107	splice site	probably null
R1725:Usp48	UTSW	4	137633422	nonsense	probably null
R2520:Usp48	UTSW	4	137625251	missense	probably benign	0.05
R2965:Usp48	UTSW	4	137613762	missense	probably damaging	1.00
R2966:Usp48	UTSW	4	137613762	missense	probably damaging	1.00
R3026:Usp48	UTSW	4	137594444	missense	probably benign	0.06
R3963:Usp48	UTSW	4	137633439	nonsense	probably null
R4087:Usp48	UTSW	4	137623340	missense	possibly damaging	0.95
R4633:Usp48	UTSW	4	137634900	missense	probably damaging	0.96
R4677:Usp48	UTSW	4	137616381	missense	probably benign	0.16
R4735:Usp48	UTSW	4	137633369	nonsense	probably null
R4932:Usp48	UTSW	4	137615833	missense	probably benign	0.00
R4932:Usp48	UTSW	4	137615834	splice site	probably null
R4935:Usp48	UTSW	4	137650358	missense	probably benign	0.42
R4952:Usp48	UTSW	4	137606693	nonsense	probably null
R5034:Usp48	UTSW	4	137606757	nonsense	probably null
R5153:Usp48	UTSW	4	137616362	missense	possibly damaging	0.68
R5443:Usp48	UTSW	4	137621221	missense	possibly damaging	0.78
R5591:Usp48	UTSW	4	137652652	intron	probably benign
R5825:Usp48	UTSW	4	137623378	missense	probably benign
R5889:Usp48	UTSW	4	137616412	missense	probably benign
R5955:Usp48	UTSW	4	137615818	missense	probably benign
R6089:Usp48	UTSW	4	137605818	missense	probably damaging	1.00
R6443:Usp48	UTSW	4	137613763	missense	probably damaging	1.00
R6473:Usp48	UTSW	4	137609108	critical splice donor site	probably null
R6482:Usp48	UTSW	4	137634921	missense	probably damaging	1.00
R6859:Usp48	UTSW	4	137625276	missense	possibly damaging	0.77
R6916:Usp48	UTSW	4	137638233	missense	probably damaging	1.00
R6977:Usp48	UTSW	4	137650360	missense	probably damaging	1.00
R7749:Usp48	UTSW	4	137650417	missense	probably damaging	1.00
R7767:Usp48	UTSW	4	137604645	critical splice donor site	probably null
R7850:Usp48	UTSW	4	137605749	splice site	probably null
R7881:Usp48	UTSW	4	137633455	missense	probably benign	0.00
R7897:Usp48	UTSW	4	137644428	missense	probably damaging	0.96
R8186:Usp48	UTSW	4	137621196	missense	possibly damaging	0.83
R8198:Usp48	UTSW	4	137621159	unclassified	probably benign
R8353:Usp48	UTSW	4	137623382	missense	probably benign	0.00
R8466:Usp48	UTSW	4	137623319	missense	probably null	1.00
R8506:Usp48	UTSW	4	137610718	missense	probably damaging	1.00
R8821:Usp48	UTSW	4	137613769	missense	probably damaging	1.00
R8831:Usp48	UTSW	4	137613769	missense	probably damaging	1.00
R8911:Usp48	UTSW	4	137613685	missense	probably benign	0.00
R9043:Usp48	UTSW	4	137613685	missense	probably benign	0.00
R9044:Usp48	UTSW	4	137613685	missense	probably benign	0.00
R9289:Usp48	UTSW	4	137613685	missense	probably benign	0.00
R9295:Usp48	UTSW	4	137613685	missense	probably benign	0.00
R9296:Usp48	UTSW	4	137613685	missense	probably benign	0.00
R9297:Usp48	UTSW	4	137613685	missense	probably benign	0.00
R9317:Usp48	UTSW	4	137613685	missense	probably benign	0.00
R9460:Usp48	UTSW	4	137613685	missense	probably benign	0.00
R9480:Usp48	UTSW	4	137613685	missense	probably benign	0.00
R9481:Usp48	UTSW	4	137613685	missense	probably benign	0.00
R9520:Usp48	UTSW	4	137613685	missense	probably benign	0.00
R9521:Usp48	UTSW	4	137613685	missense	probably benign	0.00
R9522:Usp48	UTSW	4	137613685	missense	probably benign	0.00
R9627:Usp48	UTSW	4	137613685	missense	probably benign	0.00
R9698:Usp48	UTSW	4	137633891	missense	possibly damaging	0.94
R9752:Usp48	UTSW	4	137613826	missense	probably damaging	1.00
R9784:Usp48	UTSW	4	137594501	missense	probably benign	0.06
RF002:Usp48	UTSW	4	137605795	missense	probably damaging	1.00
Z1176:Usp48	UTSW	4	137604637	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TTGACTGCTCTCCTGTCTGAGG -3'
(R):5'- CCAGCGTTACTTACTAAGCCC -3'

Sequencing Primer
(F):5'- TCTCCTGTCTGAGGGCAGC -3'
(R):5'- ATCTTCAGGATGCGAGCCCAG -3'

Posted On

2019-11-26