Incidental Mutation 'R7759:Arhgef16'
ID 597714
Institutional Source Beutler Lab
Gene Symbol Arhgef16
Ensembl Gene ENSMUSG00000029032
Gene Name Rho guanine nucleotide exchange factor (GEF) 16
Synonyms Neuroblastoma
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 154278486-154301676 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 154286975 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 254 (T254A)
Ref Sequence ENSEMBL: ENSMUSP00000030898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030898] [ENSMUST00000152947] [ENSMUST00000154895] [ENSMUST00000169623]
AlphaFold Q3U5C8
Predicted Effect probably benign
Transcript: ENSMUST00000030898
AA Change: T254A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000030898
Gene: ENSMUSG00000029032
AA Change: T254A

DomainStartEndE-ValueType
low complexity region 51 72 N/A INTRINSIC
RhoGEF 292 471 5.9e-52 SMART
PH 506 626 6.46e-8 SMART
SH3 636 692 2.31e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152947
SMART Domains Protein: ENSMUSP00000119398
Gene: ENSMUSG00000029032

DomainStartEndE-ValueType
low complexity region 51 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154895
SMART Domains Protein: ENSMUSP00000121273
Gene: ENSMUSG00000029032

DomainStartEndE-ValueType
low complexity region 51 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169623
AA Change: T254A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000126296
Gene: ENSMUSG00000029032
AA Change: T254A

DomainStartEndE-ValueType
low complexity region 51 72 N/A INTRINSIC
RhoGEF 292 471 5.9e-52 SMART
PH 506 626 6.46e-8 SMART
SH3 636 692 2.31e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Although the specific function of this protein is not known yet, it is thought to be involved in protein-protein and protein-lipid interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G T 16: 4,864,650 G215V probably benign Het
Adamts1 C A 16: 85,797,795 G652C probably damaging Het
Adck1 G A 12: 88,402,117 A122T possibly damaging Het
Akap1 A C 11: 88,845,833 M34R probably damaging Het
Apc2 C T 10: 80,311,196 R695C probably damaging Het
Apon T A 10: 128,254,515 W21R probably benign Het
Arid5b T A 10: 68,097,802 S757C probably damaging Het
B020004C17Rik A C 14: 57,016,785 I122L possibly damaging Het
Bckdhb T G 9: 84,010,326 V270G probably damaging Het
Cacna1d A G 14: 30,099,188 Y1146H probably benign Het
Carmil2 A G 8: 105,697,036 D1214G possibly damaging Het
Ccdc142 T C 6: 83,107,931 V636A probably benign Het
Chd9 T C 8: 90,977,550 probably null Het
Csmd3 A G 15: 47,698,173 S1336P Het
Cubn A G 2: 13,348,150 Y1926H probably damaging Het
Ddx58 C A 4: 40,225,104 A298S probably damaging Het
Dock4 A T 12: 40,817,736 D1437V probably damaging Het
Eme1 A T 11: 94,645,840 Y504* probably null Het
Enah G A 1: 181,918,444 A687V unknown Het
Endou A C 15: 97,713,866 V339G probably damaging Het
Ephb6 G A 6: 41,614,605 R232H probably benign Het
Ephx2 G A 14: 66,089,519 A409V possibly damaging Het
Esd T A 14: 74,745,567 C219* probably null Het
Fscb A T 12: 64,474,092 M200K probably benign Het
Gabra6 A T 11: 42,317,681 V108D probably damaging Het
Gm11555 A G 11: 99,649,742 V137A unknown Het
Gpld1 A G 13: 24,962,400 D209G probably damaging Het
Ikzf1 T A 11: 11,769,256 I408N probably damaging Het
Itgb4 A G 11: 116,003,710 R1364G possibly damaging Het
Kif26b A C 1: 178,678,944 K195T probably damaging Het
Mfsd12 T C 10: 81,363,593 W440R probably benign Het
Mtrr C T 13: 68,570,027 E373K probably damaging Het
Mug2 T A 6: 122,081,358 V1293E probably damaging Het
Myof C A 19: 37,939,898 A1068S probably benign Het
Ncam2 A G 16: 81,615,784 D720G probably damaging Het
Nova2 G T 7: 18,958,251 G435V Het
Oacyl T A 18: 65,710,560 D109E probably damaging Het
Olfr1393 A T 11: 49,280,636 M163L probably benign Het
Olfr684 G A 7: 105,157,025 S219F probably damaging Het
Pdcd11 G A 19: 47,113,198 V941M possibly damaging Het
Pdzd8 C A 19: 59,299,926 R1014L probably damaging Het
Ppm1h T G 10: 122,904,113 D364E probably benign Het
Rp1 T C 1: 4,344,884 N2002D probably benign Het
Sall1 C T 8: 89,042,351 probably null Het
Scn10a C T 9: 119,648,132 W728* probably null Het
Setdb2 G T 14: 59,419,364 T168K probably damaging Het
Sgms1 T C 19: 32,159,876 I97V probably benign Het
Slc8a3 A T 12: 81,314,551 M498K probably benign Het
Smpd4 A T 16: 17,638,633 E362D probably damaging Het
Ssc5d A T 7: 4,937,530 K881* probably null Het
Strn4 A G 7: 16,830,384 E313G probably damaging Het
Tas2r113 A T 6: 132,893,927 N306I possibly damaging Het
Tdrd6 G T 17: 43,624,839 R1773S probably benign Het
Thbs2 T C 17: 14,677,059 E729G probably damaging Het
Tnfrsf23 G A 7: 143,670,835 T135I probably damaging Het
Tollip A G 7: 141,884,539 M218T probably benign Het
Tyk2 A T 9: 21,120,258 probably null Het
Ubr2 G A 17: 46,986,048 R269C probably damaging Het
Uggt1 A T 1: 36,146,725 M1459K possibly damaging Het
Upf1 A G 8: 70,334,080 V929A probably benign Het
Usp48 T C 4: 137,594,452 S24P probably benign Het
Vmn1r214 G A 13: 23,034,461 E42K not run Het
Vmn1r83 G T 7: 12,321,433 D232E probably benign Het
Vmn2r25 C T 6: 123,823,380 V668I probably damaging Het
Vmn2r6 A G 3: 64,556,570 I281T probably damaging Het
Ywhag A T 5: 135,911,189 Y184N probably damaging Het
Zdbf2 A C 1: 63,308,376 E1971D possibly damaging Het
Zfp568 G A 7: 30,023,414 A595T possibly damaging Het
Zfy2 T C Y: 2,117,083 D248G probably benign Het
Other mutations in Arhgef16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Arhgef16 APN 4 154280244 missense probably benign 0.01
IGL02422:Arhgef16 APN 4 154287065 nonsense probably null
IGL02801:Arhgef16 APN 4 154291507 missense probably damaging 0.99
IGL02928:Arhgef16 APN 4 154282893 missense probably benign 0.00
R0518:Arhgef16 UTSW 4 154291034 missense probably damaging 0.99
R1148:Arhgef16 UTSW 4 154280889 missense probably benign 0.05
R1148:Arhgef16 UTSW 4 154280889 missense probably benign 0.05
R1576:Arhgef16 UTSW 4 154291312 missense probably damaging 1.00
R1778:Arhgef16 UTSW 4 154287986 missense probably benign 0.17
R1853:Arhgef16 UTSW 4 154291106 missense probably benign 0.14
R1912:Arhgef16 UTSW 4 154280323 splice site probably null
R2269:Arhgef16 UTSW 4 154285033 missense probably damaging 0.98
R4437:Arhgef16 UTSW 4 154279696 critical splice donor site probably null
R4690:Arhgef16 UTSW 4 154287963 splice site probably null
R5174:Arhgef16 UTSW 4 154282047 missense probably damaging 1.00
R5566:Arhgef16 UTSW 4 154285648 missense probably benign 0.01
R6348:Arhgef16 UTSW 4 154287083 missense probably benign 0.18
R7264:Arhgef16 UTSW 4 154280930 missense probably damaging 1.00
R7469:Arhgef16 UTSW 4 154291306 missense probably damaging 1.00
R7626:Arhgef16 UTSW 4 154282882 missense possibly damaging 0.89
R7651:Arhgef16 UTSW 4 154291067 missense probably damaging 1.00
R7684:Arhgef16 UTSW 4 154281828 missense possibly damaging 0.62
R8334:Arhgef16 UTSW 4 154282767 nonsense probably null
R8993:Arhgef16 UTSW 4 154287038 missense probably damaging 1.00
R8995:Arhgef16 UTSW 4 154287038 missense probably damaging 1.00
R9141:Arhgef16 UTSW 4 154281843 missense probably damaging 1.00
R9256:Arhgef16 UTSW 4 154279045 nonsense probably null
R9266:Arhgef16 UTSW 4 154291465 missense probably benign 0.14
R9426:Arhgef16 UTSW 4 154281843 missense probably damaging 1.00
R9515:Arhgef16 UTSW 4 154280975 missense possibly damaging 0.65
R9516:Arhgef16 UTSW 4 154280975 missense possibly damaging 0.65
R9784:Arhgef16 UTSW 4 154286965 missense probably damaging 1.00
Z1177:Arhgef16 UTSW 4 154281453 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCTAAAATCTGTTAAGGGCC -3'
(R):5'- TGCTACACTCTTCCAGGCTG -3'

Sequencing Primer
(F):5'- CTCTAAAATCTGTTAAGGGCCTGAGC -3'
(R):5'- ACTGTAGGACCCAGTGAGC -3'
Posted On 2019-11-26