Incidental Mutation 'R7759:Vmn2r25'
ID 597719
Institutional Source Beutler Lab
Gene Symbol Vmn2r25
Ensembl Gene ENSMUSG00000094672
Gene Name vomeronasal 2, receptor 25
Synonyms EG545874
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R7759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 123822814-123853190 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 123823380 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 668 (V668I)
Ref Sequence ENSEMBL: ENSMUSP00000124342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162046]
AlphaFold W4VSP2
Predicted Effect probably damaging
Transcript: ENSMUST00000162046
AA Change: V668I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124342
Gene: ENSMUSG00000094672
AA Change: V668I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 473 6e-31 PFAM
Pfam:NCD3G 519 572 5.8e-25 PFAM
Pfam:7tm_3 603 840 4.8e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G T 16: 4,864,650 G215V probably benign Het
Adamts1 C A 16: 85,797,795 G652C probably damaging Het
Adck1 G A 12: 88,402,117 A122T possibly damaging Het
Akap1 A C 11: 88,845,833 M34R probably damaging Het
Apc2 C T 10: 80,311,196 R695C probably damaging Het
Apon T A 10: 128,254,515 W21R probably benign Het
Arhgef16 T C 4: 154,286,975 T254A probably benign Het
Arid5b T A 10: 68,097,802 S757C probably damaging Het
B020004C17Rik A C 14: 57,016,785 I122L possibly damaging Het
Bckdhb T G 9: 84,010,326 V270G probably damaging Het
Cacna1d A G 14: 30,099,188 Y1146H probably benign Het
Carmil2 A G 8: 105,697,036 D1214G possibly damaging Het
Ccdc142 T C 6: 83,107,931 V636A probably benign Het
Chd9 T C 8: 90,977,550 probably null Het
Csmd3 A G 15: 47,698,173 S1336P Het
Cubn A G 2: 13,348,150 Y1926H probably damaging Het
Ddx58 C A 4: 40,225,104 A298S probably damaging Het
Dock4 A T 12: 40,817,736 D1437V probably damaging Het
Eme1 A T 11: 94,645,840 Y504* probably null Het
Enah G A 1: 181,918,444 A687V unknown Het
Endou A C 15: 97,713,866 V339G probably damaging Het
Ephb6 G A 6: 41,614,605 R232H probably benign Het
Ephx2 G A 14: 66,089,519 A409V possibly damaging Het
Esd T A 14: 74,745,567 C219* probably null Het
Fscb A T 12: 64,474,092 M200K probably benign Het
Gabra6 A T 11: 42,317,681 V108D probably damaging Het
Gm11555 A G 11: 99,649,742 V137A unknown Het
Gpld1 A G 13: 24,962,400 D209G probably damaging Het
Ikzf1 T A 11: 11,769,256 I408N probably damaging Het
Itgb4 A G 11: 116,003,710 R1364G possibly damaging Het
Kif26b A C 1: 178,678,944 K195T probably damaging Het
Mfsd12 T C 10: 81,363,593 W440R probably benign Het
Mtrr C T 13: 68,570,027 E373K probably damaging Het
Mug2 T A 6: 122,081,358 V1293E probably damaging Het
Myof C A 19: 37,939,898 A1068S probably benign Het
Ncam2 A G 16: 81,615,784 D720G probably damaging Het
Nova2 G T 7: 18,958,251 G435V Het
Oacyl T A 18: 65,710,560 D109E probably damaging Het
Olfr1393 A T 11: 49,280,636 M163L probably benign Het
Olfr684 G A 7: 105,157,025 S219F probably damaging Het
Pdcd11 G A 19: 47,113,198 V941M possibly damaging Het
Pdzd8 C A 19: 59,299,926 R1014L probably damaging Het
Ppm1h T G 10: 122,904,113 D364E probably benign Het
Rp1 T C 1: 4,344,884 N2002D probably benign Het
Sall1 C T 8: 89,042,351 probably null Het
Scn10a C T 9: 119,648,132 W728* probably null Het
Setdb2 G T 14: 59,419,364 T168K probably damaging Het
Sgms1 T C 19: 32,159,876 I97V probably benign Het
Slc8a3 A T 12: 81,314,551 M498K probably benign Het
Smpd4 A T 16: 17,638,633 E362D probably damaging Het
Ssc5d A T 7: 4,937,530 K881* probably null Het
Strn4 A G 7: 16,830,384 E313G probably damaging Het
Tas2r113 A T 6: 132,893,927 N306I possibly damaging Het
Tdrd6 G T 17: 43,624,839 R1773S probably benign Het
Thbs2 T C 17: 14,677,059 E729G probably damaging Het
Tnfrsf23 G A 7: 143,670,835 T135I probably damaging Het
Tollip A G 7: 141,884,539 M218T probably benign Het
Tyk2 A T 9: 21,120,258 probably null Het
Ubr2 G A 17: 46,986,048 R269C probably damaging Het
Uggt1 A T 1: 36,146,725 M1459K possibly damaging Het
Upf1 A G 8: 70,334,080 V929A probably benign Het
Usp48 T C 4: 137,594,452 S24P probably benign Het
Vmn1r214 G A 13: 23,034,461 E42K not run Het
Vmn1r83 G T 7: 12,321,433 D232E probably benign Het
Vmn2r6 A G 3: 64,556,570 I281T probably damaging Het
Ywhag A T 5: 135,911,189 Y184N probably damaging Het
Zdbf2 A C 1: 63,308,376 E1971D possibly damaging Het
Zfp568 G A 7: 30,023,414 A595T possibly damaging Het
Zfy2 T C Y: 2,117,083 D248G probably benign Het
Other mutations in Vmn2r25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Vmn2r25 APN 6 123853171 missense probably benign 0.25
IGL01781:Vmn2r25 APN 6 123839365 missense possibly damaging 0.48
IGL01843:Vmn2r25 APN 6 123853003 missense possibly damaging 0.67
IGL02023:Vmn2r25 APN 6 123839429 missense probably damaging 0.96
IGL02502:Vmn2r25 APN 6 123839433 missense probably damaging 0.96
IGL02709:Vmn2r25 APN 6 123839764 missense possibly damaging 0.50
IGL03053:Vmn2r25 APN 6 123823118 missense probably damaging 1.00
PIT4468001:Vmn2r25 UTSW 6 123839598 missense probably benign 0.00
PIT4812001:Vmn2r25 UTSW 6 123823488 missense probably damaging 1.00
R0054:Vmn2r25 UTSW 6 123853025 missense probably benign 0.00
R0312:Vmn2r25 UTSW 6 123828580 splice site probably benign
R0366:Vmn2r25 UTSW 6 123823622 nonsense probably null
R0390:Vmn2r25 UTSW 6 123823181 missense probably damaging 1.00
R0466:Vmn2r25 UTSW 6 123852049 missense probably benign 0.16
R0541:Vmn2r25 UTSW 6 123839827 missense probably damaging 0.97
R0612:Vmn2r25 UTSW 6 123839522 missense probably damaging 1.00
R0865:Vmn2r25 UTSW 6 123853017 missense probably benign 0.09
R1219:Vmn2r25 UTSW 6 123839323 missense probably benign 0.00
R1240:Vmn2r25 UTSW 6 123851905 missense probably damaging 0.98
R1701:Vmn2r25 UTSW 6 123851795 splice site probably null
R1780:Vmn2r25 UTSW 6 123828465 missense probably damaging 1.00
R1809:Vmn2r25 UTSW 6 123825378 missense probably benign 0.00
R1833:Vmn2r25 UTSW 6 123839684 missense probably benign 0.01
R1964:Vmn2r25 UTSW 6 123823295 missense possibly damaging 0.94
R2154:Vmn2r25 UTSW 6 123839846 missense probably benign 0.01
R2164:Vmn2r25 UTSW 6 123839559 missense possibly damaging 0.96
R3799:Vmn2r25 UTSW 6 123853184 missense probably benign 0.12
R3836:Vmn2r25 UTSW 6 123853085 missense probably damaging 1.00
R3946:Vmn2r25 UTSW 6 123840098 missense probably damaging 0.97
R4282:Vmn2r25 UTSW 6 123823647 missense probably damaging 1.00
R4367:Vmn2r25 UTSW 6 123828537 missense probably damaging 1.00
R4438:Vmn2r25 UTSW 6 123839797 missense probably benign 0.03
R4488:Vmn2r25 UTSW 6 123822860 missense probably damaging 1.00
R4580:Vmn2r25 UTSW 6 123823023 missense possibly damaging 0.46
R4631:Vmn2r25 UTSW 6 123853003 missense possibly damaging 0.94
R4765:Vmn2r25 UTSW 6 123823223 missense probably damaging 1.00
R4908:Vmn2r25 UTSW 6 123828447 missense probably benign
R5207:Vmn2r25 UTSW 6 123840103 missense probably damaging 1.00
R5254:Vmn2r25 UTSW 6 123825318 missense probably damaging 1.00
R5444:Vmn2r25 UTSW 6 123828492 missense probably benign 0.00
R5586:Vmn2r25 UTSW 6 123825296 missense probably damaging 1.00
R5607:Vmn2r25 UTSW 6 123828359 missense possibly damaging 0.49
R5985:Vmn2r25 UTSW 6 123823628 missense probably benign
R6046:Vmn2r25 UTSW 6 123822917 missense probably damaging 1.00
R6057:Vmn2r25 UTSW 6 123822941 missense possibly damaging 0.69
R6569:Vmn2r25 UTSW 6 123851982 missense probably benign 0.01
R6826:Vmn2r25 UTSW 6 123823112 missense probably damaging 1.00
R7054:Vmn2r25 UTSW 6 123823610 missense probably damaging 1.00
R7120:Vmn2r25 UTSW 6 123828435 missense possibly damaging 0.51
R7177:Vmn2r25 UTSW 6 123839923 missense possibly damaging 0.94
R7287:Vmn2r25 UTSW 6 123852081 missense possibly damaging 0.49
R7397:Vmn2r25 UTSW 6 123823539 missense probably damaging 0.96
R7486:Vmn2r25 UTSW 6 123823142 missense probably damaging 1.00
R7699:Vmn2r25 UTSW 6 123839923 missense possibly damaging 0.94
R7700:Vmn2r25 UTSW 6 123839923 missense possibly damaging 0.94
R7802:Vmn2r25 UTSW 6 123851832 missense possibly damaging 0.88
R7850:Vmn2r25 UTSW 6 123828472 missense probably damaging 1.00
R8064:Vmn2r25 UTSW 6 123823622 nonsense probably null
R8170:Vmn2r25 UTSW 6 123853017 missense probably benign 0.09
R8340:Vmn2r25 UTSW 6 123853013 missense probably benign 0.01
R8346:Vmn2r25 UTSW 6 123825391 missense probably benign 0.00
R8395:Vmn2r25 UTSW 6 123823023 missense possibly damaging 0.81
R8889:Vmn2r25 UTSW 6 123823610 missense probably damaging 1.00
R9094:Vmn2r25 UTSW 6 123828432 missense probably benign 0.44
R9204:Vmn2r25 UTSW 6 123853133 missense probably benign 0.00
R9253:Vmn2r25 UTSW 6 123840001 missense probably damaging 0.98
R9392:Vmn2r25 UTSW 6 123839978 missense probably benign
R9520:Vmn2r25 UTSW 6 123853107 nonsense probably null
R9525:Vmn2r25 UTSW 6 123823205 missense probably damaging 1.00
R9622:Vmn2r25 UTSW 6 123839620 missense probably damaging 0.99
X0020:Vmn2r25 UTSW 6 123839400 missense possibly damaging 0.95
Z1176:Vmn2r25 UTSW 6 123822897 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGTTCCCAGCCAGACTGC -3'
(R):5'- CCACTGGGAACTGTTCTTGTC -3'

Sequencing Primer
(F):5'- CACAGATGCACACTTGAATGATG -3'
(R):5'- GCCTTTTCAGCTATGATTCTAGG -3'
Posted On 2019-11-26