Incidental Mutation 'R7759:Ssc5d'
ID597721
Institutional Source Beutler Lab
Gene Symbol Ssc5d
Ensembl Gene ENSMUSG00000035279
Gene Namescavenger receptor cysteine rich family, 5 domains
Synonymss5d-srcrb, A430110N23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7759 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4925785-4944826 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 4937530 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 881 (K881*)
Ref Sequence ENSEMBL: ENSMUSP00000052126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057612] [ENSMUST00000208109]
Predicted Effect probably null
Transcript: ENSMUST00000057612
AA Change: K881*
SMART Domains Protein: ENSMUSP00000052126
Gene: ENSMUSG00000035279
AA Change: K881*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SR 20 120 4.44e-49 SMART
low complexity region 141 155 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
SR 199 299 2.36e-53 SMART
SR 305 405 8.22e-53 SMART
low complexity region 437 462 N/A INTRINSIC
SR 464 565 1.11e-49 SMART
low complexity region 741 755 N/A INTRINSIC
SR 758 858 3.93e-50 SMART
low complexity region 936 957 N/A INTRINSIC
low complexity region 981 1004 N/A INTRINSIC
low complexity region 1018 1035 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1357 1364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208109
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G T 16: 4,864,650 G215V probably benign Het
Adamts1 C A 16: 85,797,795 G652C probably damaging Het
Adck1 G A 12: 88,402,117 A122T possibly damaging Het
Akap1 A C 11: 88,845,833 M34R probably damaging Het
Apc2 C T 10: 80,311,196 R695C probably damaging Het
Apon T A 10: 128,254,515 W21R probably benign Het
Arhgef16 T C 4: 154,286,975 T254A probably benign Het
Arid5b T A 10: 68,097,802 S757C probably damaging Het
B020004C17Rik A C 14: 57,016,785 I122L possibly damaging Het
Bckdhb T G 9: 84,010,326 V270G probably damaging Het
Cacna1d A G 14: 30,099,188 Y1146H probably benign Het
Carmil2 A G 8: 105,697,036 D1214G possibly damaging Het
Ccdc142 T C 6: 83,107,931 V636A probably benign Het
Chd9 T C 8: 90,977,550 probably null Het
Csmd3 A G 15: 47,698,173 S1336P Het
Cubn A G 2: 13,348,150 Y1926H probably damaging Het
Ddx58 C A 4: 40,225,104 A298S probably damaging Het
Dock4 A T 12: 40,817,736 D1437V probably damaging Het
Eme1 A T 11: 94,645,840 Y504* probably null Het
Enah G A 1: 181,918,444 A687V unknown Het
Endou A C 15: 97,713,866 V339G probably damaging Het
Ephb6 G A 6: 41,614,605 R232H probably benign Het
Ephx2 G A 14: 66,089,519 A409V possibly damaging Het
Esd T A 14: 74,745,567 C219* probably null Het
Fscb A T 12: 64,474,092 M200K probably benign Het
Gabra6 A T 11: 42,317,681 V108D probably damaging Het
Gm11555 A G 11: 99,649,742 V137A unknown Het
Gpld1 A G 13: 24,962,400 D209G probably damaging Het
Ikzf1 T A 11: 11,769,256 I408N probably damaging Het
Itgb4 A G 11: 116,003,710 R1364G possibly damaging Het
Kif26b A C 1: 178,678,944 K195T probably damaging Het
Mfsd12 T C 10: 81,363,593 W440R probably benign Het
Mtrr C T 13: 68,570,027 E373K probably damaging Het
Mug2 T A 6: 122,081,358 V1293E probably damaging Het
Myof C A 19: 37,939,898 A1068S probably benign Het
Ncam2 A G 16: 81,615,784 D720G probably damaging Het
Nova2 G T 7: 18,958,251 G435V Het
Oacyl T A 18: 65,710,560 D109E probably damaging Het
Olfr1393 A T 11: 49,280,636 M163L probably benign Het
Olfr684 G A 7: 105,157,025 S219F probably damaging Het
Pdcd11 G A 19: 47,113,198 V941M possibly damaging Het
Pdzd8 C A 19: 59,299,926 R1014L probably damaging Het
Ppm1h T G 10: 122,904,113 D364E probably benign Het
Rp1 T C 1: 4,344,884 N2002D probably benign Het
Sall1 C T 8: 89,042,351 probably null Het
Scn10a C T 9: 119,648,132 W728* probably null Het
Setdb2 G T 14: 59,419,364 T168K probably damaging Het
Sgms1 T C 19: 32,159,876 I97V probably benign Het
Slc8a3 A T 12: 81,314,551 M498K probably benign Het
Smpd4 A T 16: 17,638,633 E362D probably damaging Het
Strn4 A G 7: 16,830,384 E313G probably damaging Het
Tas2r113 A T 6: 132,893,927 N306I possibly damaging Het
Tdrd6 G T 17: 43,624,839 R1773S probably benign Het
Thbs2 T C 17: 14,677,059 E729G probably damaging Het
Tnfrsf23 G A 7: 143,670,835 T135I probably damaging Het
Tollip A G 7: 141,884,539 M218T probably benign Het
Tyk2 A T 9: 21,120,258 probably null Het
Ubr2 G A 17: 46,986,048 R269C probably damaging Het
Uggt1 A T 1: 36,146,725 M1459K possibly damaging Het
Upf1 A G 8: 70,334,080 V929A probably benign Het
Usp48 T C 4: 137,594,452 S24P probably benign Het
Vmn1r214 G A 13: 23,034,461 E42K not run Het
Vmn1r83 G T 7: 12,321,433 D232E probably benign Het
Vmn2r25 C T 6: 123,823,380 V668I probably damaging Het
Vmn2r6 A G 3: 64,556,570 I281T probably damaging Het
Ywhag A T 5: 135,911,189 Y184N probably damaging Het
Zdbf2 A C 1: 63,308,376 E1971D possibly damaging Het
Zfp568 G A 7: 30,023,414 A595T possibly damaging Het
Zfy2 T C Y: 2,117,083 D248G probably benign Het
Other mutations in Ssc5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Ssc5d APN 7 4944481 missense possibly damaging 0.63
IGL00939:Ssc5d APN 7 4936281 missense possibly damaging 0.89
IGL01109:Ssc5d APN 7 4937112 nonsense probably null
IGL01409:Ssc5d APN 7 4942809 missense probably benign 0.16
IGL01880:Ssc5d APN 7 4933219 missense probably damaging 1.00
IGL02013:Ssc5d APN 7 4943836 missense probably benign 0.00
IGL02227:Ssc5d APN 7 4933454 critical splice donor site probably null
IGL02963:Ssc5d APN 7 4944327 missense probably benign 0.02
D4043:Ssc5d UTSW 7 4943983 missense possibly damaging 0.70
D4216:Ssc5d UTSW 7 4943983 missense possibly damaging 0.70
R0104:Ssc5d UTSW 7 4936286 missense probably benign 0.41
R0115:Ssc5d UTSW 7 4927881 unclassified probably benign
R0201:Ssc5d UTSW 7 4944663 missense probably benign
R0365:Ssc5d UTSW 7 4928467 nonsense probably null
R0485:Ssc5d UTSW 7 4937471 missense probably damaging 0.99
R0967:Ssc5d UTSW 7 4944343 nonsense probably null
R1607:Ssc5d UTSW 7 4944043 missense probably benign 0.25
R1639:Ssc5d UTSW 7 4928417 missense probably damaging 1.00
R1801:Ssc5d UTSW 7 4936607 missense probably benign 0.05
R1867:Ssc5d UTSW 7 4928507 missense probably damaging 1.00
R1999:Ssc5d UTSW 7 4942714 missense possibly damaging 0.86
R2007:Ssc5d UTSW 7 4928629 missense probably damaging 1.00
R2084:Ssc5d UTSW 7 4937012 missense probably benign 0.01
R2234:Ssc5d UTSW 7 4943850 missense probably benign
R2259:Ssc5d UTSW 7 4943916 missense probably benign 0.01
R2567:Ssc5d UTSW 7 4936335 missense probably damaging 1.00
R2879:Ssc5d UTSW 7 4936907 critical splice acceptor site probably null
R3782:Ssc5d UTSW 7 4942791 missense probably benign 0.00
R3875:Ssc5d UTSW 7 4927262 missense probably damaging 1.00
R4322:Ssc5d UTSW 7 4928450 missense probably damaging 1.00
R4331:Ssc5d UTSW 7 4942726 missense probably benign 0.00
R4334:Ssc5d UTSW 7 4943664 missense probably benign
R4430:Ssc5d UTSW 7 4943664 missense probably benign
R4619:Ssc5d UTSW 7 4929525 missense probably damaging 1.00
R4794:Ssc5d UTSW 7 4943745 missense probably benign
R5106:Ssc5d UTSW 7 4936665 missense probably benign 0.31
R5174:Ssc5d UTSW 7 4927971 missense possibly damaging 0.83
R5553:Ssc5d UTSW 7 4936290 missense probably damaging 1.00
R5649:Ssc5d UTSW 7 4926518 critical splice donor site probably null
R5786:Ssc5d UTSW 7 4936818 missense probably benign 0.00
R6059:Ssc5d UTSW 7 4942744 missense possibly damaging 0.86
R6163:Ssc5d UTSW 7 4927254 missense probably damaging 1.00
R6332:Ssc5d UTSW 7 4937522 missense probably damaging 1.00
R6341:Ssc5d UTSW 7 4936665 missense probably benign 0.31
R6613:Ssc5d UTSW 7 4933293 missense possibly damaging 0.82
R7180:Ssc5d UTSW 7 4936601 missense probably benign 0.17
R7576:Ssc5d UTSW 7 4928573 missense probably damaging 1.00
R7602:Ssc5d UTSW 7 4942746 missense possibly damaging 0.95
R7609:Ssc5d UTSW 7 4927576 missense possibly damaging 0.56
R7691:Ssc5d UTSW 7 4944169 missense probably benign 0.29
X0063:Ssc5d UTSW 7 4936287 missense probably damaging 1.00
Z1088:Ssc5d UTSW 7 4928434 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCGTTGGTGTCTAAAGGTC -3'
(R):5'- AGAGCTCCACCATTTTGACTC -3'

Sequencing Primer
(F):5'- TGGTGTCTAAAGGTCTAAGGAGC -3'
(R):5'- TGACTCTGACCTCATCACACATG -3'
Posted On2019-11-26