Incidental Mutation 'R7759:Strn4'
ID 597723
Institutional Source Beutler Lab
Gene Symbol Strn4
Ensembl Gene ENSMUSG00000030374
Gene Name striatin, calmodulin binding protein 4
Synonyms ZIN, zinedin
MMRRC Submission 045815-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.836) question?
Stock # R7759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 16549814-16574856 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 16564309 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 313 (E313G)
Ref Sequence ENSEMBL: ENSMUSP00000019220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019220] [ENSMUST00000108495] [ENSMUST00000185011]
AlphaFold P58404
Predicted Effect probably damaging
Transcript: ENSMUST00000019220
AA Change: E313G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019220
Gene: ENSMUSG00000030374
AA Change: E313G

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 21 60 N/A INTRINSIC
Pfam:Striatin 64 193 1.2e-44 PFAM
low complexity region 217 236 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
low complexity region 367 382 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
WD40 434 473 5.72e-9 SMART
WD40 487 526 6.53e-4 SMART
WD40 540 579 6.99e-13 SMART
WD40 584 626 2.38e1 SMART
WD40 629 672 3.55e1 SMART
WD40 675 714 5.34e-9 SMART
WD40 717 760 1.58e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108495
AA Change: E313G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104135
Gene: ENSMUSG00000030374
AA Change: E313G

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 21 60 N/A INTRINSIC
Pfam:Striatin 64 197 1.4e-45 PFAM
low complexity region 217 236 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
low complexity region 367 382 N/A INTRINSIC
low complexity region 409 422 N/A INTRINSIC
WD40 427 466 5.72e-9 SMART
WD40 480 519 6.53e-4 SMART
WD40 533 572 6.99e-13 SMART
WD40 577 619 2.38e1 SMART
WD40 622 665 3.55e1 SMART
WD40 668 707 5.34e-9 SMART
WD40 710 753 1.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184280
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000185011
SMART Domains Protein: ENSMUSP00000139290
Gene: ENSMUSG00000030374

DomainStartEndE-ValueType
low complexity region 33 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G T 16: 4,682,514 (GRCm39) G215V probably benign Het
Adamts1 C A 16: 85,594,683 (GRCm39) G652C probably damaging Het
Adck1 G A 12: 88,368,887 (GRCm39) A122T possibly damaging Het
Akap1 A C 11: 88,736,659 (GRCm39) M34R probably damaging Het
Apc2 C T 10: 80,147,030 (GRCm39) R695C probably damaging Het
Apon T A 10: 128,090,384 (GRCm39) W21R probably benign Het
Arhgef16 T C 4: 154,371,432 (GRCm39) T254A probably benign Het
Arid5b T A 10: 67,933,632 (GRCm39) S757C probably damaging Het
B020004C17Rik A C 14: 57,254,242 (GRCm39) I122L possibly damaging Het
Bckdhb T G 9: 83,892,379 (GRCm39) V270G probably damaging Het
Cacna1d A G 14: 29,821,145 (GRCm39) Y1146H probably benign Het
Carmil2 A G 8: 106,423,668 (GRCm39) D1214G possibly damaging Het
Ccdc142 T C 6: 83,084,912 (GRCm39) V636A probably benign Het
Chd9 T C 8: 91,704,178 (GRCm39) probably null Het
Csmd3 A G 15: 47,561,569 (GRCm39) S1336P Het
Cubn A G 2: 13,352,961 (GRCm39) Y1926H probably damaging Het
Dock4 A T 12: 40,867,735 (GRCm39) D1437V probably damaging Het
Eme1 A T 11: 94,536,666 (GRCm39) Y504* probably null Het
Enah G A 1: 181,746,009 (GRCm39) A687V unknown Het
Endou A C 15: 97,611,747 (GRCm39) V339G probably damaging Het
Ephb6 G A 6: 41,591,539 (GRCm39) R232H probably benign Het
Ephx2 G A 14: 66,326,968 (GRCm39) A409V possibly damaging Het
Esd T A 14: 74,983,007 (GRCm39) C219* probably null Het
Fscb A T 12: 64,520,866 (GRCm39) M200K probably benign Het
Gabra6 A T 11: 42,208,508 (GRCm39) V108D probably damaging Het
Gm11555 A G 11: 99,540,568 (GRCm39) V137A unknown Het
Gpld1 A G 13: 25,146,383 (GRCm39) D209G probably damaging Het
Ikzf1 T A 11: 11,719,256 (GRCm39) I408N probably damaging Het
Itgb4 A G 11: 115,894,536 (GRCm39) R1364G possibly damaging Het
Kif26b A C 1: 178,506,509 (GRCm39) K195T probably damaging Het
Mfsd12 T C 10: 81,199,427 (GRCm39) W440R probably benign Het
Mtrr C T 13: 68,718,146 (GRCm39) E373K probably damaging Het
Mug2 T A 6: 122,058,317 (GRCm39) V1293E probably damaging Het
Myof C A 19: 37,928,346 (GRCm39) A1068S probably benign Het
Ncam2 A G 16: 81,412,672 (GRCm39) D720G probably damaging Het
Nova2 G T 7: 18,692,176 (GRCm39) G435V Het
Oacyl T A 18: 65,843,631 (GRCm39) D109E probably damaging Het
Or2y1g A T 11: 49,171,463 (GRCm39) M163L probably benign Het
Or56a4 G A 7: 104,806,232 (GRCm39) S219F probably damaging Het
Pdcd11 G A 19: 47,101,637 (GRCm39) V941M possibly damaging Het
Pdzd8 C A 19: 59,288,358 (GRCm39) R1014L probably damaging Het
Ppm1h T G 10: 122,740,018 (GRCm39) D364E probably benign Het
Rigi C A 4: 40,225,104 (GRCm39) A298S probably damaging Het
Rp1 T C 1: 4,415,107 (GRCm39) N2002D probably benign Het
Sall1 C T 8: 89,768,979 (GRCm39) probably null Het
Scn10a C T 9: 119,477,198 (GRCm39) W728* probably null Het
Setdb2 G T 14: 59,656,813 (GRCm39) T168K probably damaging Het
Sgms1 T C 19: 32,137,276 (GRCm39) I97V probably benign Het
Slc8a3 A T 12: 81,361,325 (GRCm39) M498K probably benign Het
Smpd4 A T 16: 17,456,497 (GRCm39) E362D probably damaging Het
Ssc5d A T 7: 4,940,529 (GRCm39) K881* probably null Het
Tas2r113 A T 6: 132,870,890 (GRCm39) N306I possibly damaging Het
Tdrd6 G T 17: 43,935,730 (GRCm39) R1773S probably benign Het
Thbs2 T C 17: 14,897,321 (GRCm39) E729G probably damaging Het
Tnfrsf23 G A 7: 143,224,572 (GRCm39) T135I probably damaging Het
Tollip A G 7: 141,438,276 (GRCm39) M218T probably benign Het
Tyk2 A T 9: 21,031,554 (GRCm39) probably null Het
Ubr2 G A 17: 47,296,974 (GRCm39) R269C probably damaging Het
Uggt1 A T 1: 36,185,806 (GRCm39) M1459K possibly damaging Het
Upf1 A G 8: 70,786,730 (GRCm39) V929A probably benign Het
Usp48 T C 4: 137,321,763 (GRCm39) S24P probably benign Het
Vmn1r214 G A 13: 23,218,631 (GRCm39) E42K not run Het
Vmn1r83 G T 7: 12,055,360 (GRCm39) D232E probably benign Het
Vmn2r25 C T 6: 123,800,339 (GRCm39) V668I probably damaging Het
Vmn2r6 A G 3: 64,463,991 (GRCm39) I281T probably damaging Het
Ywhag A T 5: 135,940,043 (GRCm39) Y184N probably damaging Het
Zdbf2 A C 1: 63,347,535 (GRCm39) E1971D possibly damaging Het
Zfp568 G A 7: 29,722,839 (GRCm39) A595T possibly damaging Het
Zfy2 T C Y: 2,117,083 (GRCm39) D248G probably benign Het
Other mutations in Strn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Strn4 APN 7 16,564,377 (GRCm39) missense probably damaging 1.00
IGL01153:Strn4 APN 7 16,571,846 (GRCm39) missense probably damaging 1.00
IGL01748:Strn4 APN 7 16,572,227 (GRCm39) missense probably damaging 1.00
IGL03227:Strn4 APN 7 16,571,639 (GRCm39) missense possibly damaging 0.79
BB004:Strn4 UTSW 7 16,560,556 (GRCm39) missense probably null 1.00
BB014:Strn4 UTSW 7 16,560,556 (GRCm39) missense probably null 1.00
PIT4260001:Strn4 UTSW 7 16,556,434 (GRCm39) missense probably damaging 1.00
R0948:Strn4 UTSW 7 16,571,638 (GRCm39) nonsense probably null
R1876:Strn4 UTSW 7 16,572,207 (GRCm39) missense probably damaging 1.00
R1918:Strn4 UTSW 7 16,567,846 (GRCm39) missense probably damaging 1.00
R2015:Strn4 UTSW 7 16,566,953 (GRCm39) missense possibly damaging 0.85
R2250:Strn4 UTSW 7 16,560,391 (GRCm39) missense probably damaging 1.00
R3435:Strn4 UTSW 7 16,571,558 (GRCm39) missense possibly damaging 0.86
R3686:Strn4 UTSW 7 16,556,506 (GRCm39) missense probably damaging 1.00
R3688:Strn4 UTSW 7 16,556,506 (GRCm39) missense probably damaging 1.00
R3887:Strn4 UTSW 7 16,556,923 (GRCm39) unclassified probably benign
R4613:Strn4 UTSW 7 16,558,088 (GRCm39) missense possibly damaging 0.50
R4730:Strn4 UTSW 7 16,562,719 (GRCm39) missense possibly damaging 0.59
R5590:Strn4 UTSW 7 16,567,799 (GRCm39) critical splice acceptor site probably null
R5924:Strn4 UTSW 7 16,572,246 (GRCm39) missense probably damaging 1.00
R6327:Strn4 UTSW 7 16,550,384 (GRCm39) missense probably benign 0.00
R6759:Strn4 UTSW 7 16,556,978 (GRCm39) missense probably damaging 1.00
R6866:Strn4 UTSW 7 16,562,710 (GRCm39) missense probably damaging 0.97
R6976:Strn4 UTSW 7 16,564,279 (GRCm39) missense probably benign 0.20
R7779:Strn4 UTSW 7 16,565,417 (GRCm39) missense probably damaging 1.00
R7927:Strn4 UTSW 7 16,560,556 (GRCm39) missense probably null 1.00
R8174:Strn4 UTSW 7 16,562,733 (GRCm39) missense probably damaging 1.00
R8777:Strn4 UTSW 7 16,550,533 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Strn4 UTSW 7 16,550,533 (GRCm39) missense probably damaging 1.00
R8868:Strn4 UTSW 7 16,560,570 (GRCm39) missense probably benign 0.25
R9226:Strn4 UTSW 7 16,559,722 (GRCm39) intron probably benign
R9341:Strn4 UTSW 7 16,573,827 (GRCm39) missense probably damaging 0.99
R9343:Strn4 UTSW 7 16,573,827 (GRCm39) missense probably damaging 0.99
R9718:Strn4 UTSW 7 16,572,496 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGTGTGAGTGCCCAGTG -3'
(R):5'- GGCTTGAGCTATCCTTGACC -3'

Sequencing Primer
(F):5'- AGTGCCCAGTGCCCACTAC -3'
(R):5'- ACCTCGGGAAGTATATCCGTC -3'
Posted On 2019-11-26