Incidental Mutation 'R7759:Strn4'
ID 597723
Institutional Source Beutler Lab
Gene Symbol Strn4
Ensembl Gene ENSMUSG00000030374
Gene Name striatin, calmodulin binding protein 4
Synonyms ZIN, zinedin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.869) question?
Stock # R7759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 16815889-16840931 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 16830384 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 313 (E313G)
Ref Sequence ENSEMBL: ENSMUSP00000019220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019220] [ENSMUST00000108495] [ENSMUST00000185011]
AlphaFold P58404
Predicted Effect probably damaging
Transcript: ENSMUST00000019220
AA Change: E313G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019220
Gene: ENSMUSG00000030374
AA Change: E313G

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 21 60 N/A INTRINSIC
Pfam:Striatin 64 193 1.2e-44 PFAM
low complexity region 217 236 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
low complexity region 367 382 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
WD40 434 473 5.72e-9 SMART
WD40 487 526 6.53e-4 SMART
WD40 540 579 6.99e-13 SMART
WD40 584 626 2.38e1 SMART
WD40 629 672 3.55e1 SMART
WD40 675 714 5.34e-9 SMART
WD40 717 760 1.58e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108495
AA Change: E313G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104135
Gene: ENSMUSG00000030374
AA Change: E313G

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 21 60 N/A INTRINSIC
Pfam:Striatin 64 197 1.4e-45 PFAM
low complexity region 217 236 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
low complexity region 367 382 N/A INTRINSIC
low complexity region 409 422 N/A INTRINSIC
WD40 427 466 5.72e-9 SMART
WD40 480 519 6.53e-4 SMART
WD40 533 572 6.99e-13 SMART
WD40 577 619 2.38e1 SMART
WD40 622 665 3.55e1 SMART
WD40 668 707 5.34e-9 SMART
WD40 710 753 1.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184280
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000185011
SMART Domains Protein: ENSMUSP00000139290
Gene: ENSMUSG00000030374

DomainStartEndE-ValueType
low complexity region 33 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G T 16: 4,864,650 G215V probably benign Het
Adamts1 C A 16: 85,797,795 G652C probably damaging Het
Adck1 G A 12: 88,402,117 A122T possibly damaging Het
Akap1 A C 11: 88,845,833 M34R probably damaging Het
Apc2 C T 10: 80,311,196 R695C probably damaging Het
Apon T A 10: 128,254,515 W21R probably benign Het
Arhgef16 T C 4: 154,286,975 T254A probably benign Het
Arid5b T A 10: 68,097,802 S757C probably damaging Het
B020004C17Rik A C 14: 57,016,785 I122L possibly damaging Het
Bckdhb T G 9: 84,010,326 V270G probably damaging Het
Cacna1d A G 14: 30,099,188 Y1146H probably benign Het
Carmil2 A G 8: 105,697,036 D1214G possibly damaging Het
Ccdc142 T C 6: 83,107,931 V636A probably benign Het
Chd9 T C 8: 90,977,550 probably null Het
Csmd3 A G 15: 47,698,173 S1336P Het
Cubn A G 2: 13,348,150 Y1926H probably damaging Het
Ddx58 C A 4: 40,225,104 A298S probably damaging Het
Dock4 A T 12: 40,817,736 D1437V probably damaging Het
Eme1 A T 11: 94,645,840 Y504* probably null Het
Enah G A 1: 181,918,444 A687V unknown Het
Endou A C 15: 97,713,866 V339G probably damaging Het
Ephb6 G A 6: 41,614,605 R232H probably benign Het
Ephx2 G A 14: 66,089,519 A409V possibly damaging Het
Esd T A 14: 74,745,567 C219* probably null Het
Fscb A T 12: 64,474,092 M200K probably benign Het
Gabra6 A T 11: 42,317,681 V108D probably damaging Het
Gm11555 A G 11: 99,649,742 V137A unknown Het
Gpld1 A G 13: 24,962,400 D209G probably damaging Het
Ikzf1 T A 11: 11,769,256 I408N probably damaging Het
Itgb4 A G 11: 116,003,710 R1364G possibly damaging Het
Kif26b A C 1: 178,678,944 K195T probably damaging Het
Mfsd12 T C 10: 81,363,593 W440R probably benign Het
Mtrr C T 13: 68,570,027 E373K probably damaging Het
Mug2 T A 6: 122,081,358 V1293E probably damaging Het
Myof C A 19: 37,939,898 A1068S probably benign Het
Ncam2 A G 16: 81,615,784 D720G probably damaging Het
Nova2 G T 7: 18,958,251 G435V Het
Oacyl T A 18: 65,710,560 D109E probably damaging Het
Olfr1393 A T 11: 49,280,636 M163L probably benign Het
Olfr684 G A 7: 105,157,025 S219F probably damaging Het
Pdcd11 G A 19: 47,113,198 V941M possibly damaging Het
Pdzd8 C A 19: 59,299,926 R1014L probably damaging Het
Ppm1h T G 10: 122,904,113 D364E probably benign Het
Rp1 T C 1: 4,344,884 N2002D probably benign Het
Sall1 C T 8: 89,042,351 probably null Het
Scn10a C T 9: 119,648,132 W728* probably null Het
Setdb2 G T 14: 59,419,364 T168K probably damaging Het
Sgms1 T C 19: 32,159,876 I97V probably benign Het
Slc8a3 A T 12: 81,314,551 M498K probably benign Het
Smpd4 A T 16: 17,638,633 E362D probably damaging Het
Ssc5d A T 7: 4,937,530 K881* probably null Het
Tas2r113 A T 6: 132,893,927 N306I possibly damaging Het
Tdrd6 G T 17: 43,624,839 R1773S probably benign Het
Thbs2 T C 17: 14,677,059 E729G probably damaging Het
Tnfrsf23 G A 7: 143,670,835 T135I probably damaging Het
Tollip A G 7: 141,884,539 M218T probably benign Het
Tyk2 A T 9: 21,120,258 probably null Het
Ubr2 G A 17: 46,986,048 R269C probably damaging Het
Uggt1 A T 1: 36,146,725 M1459K possibly damaging Het
Upf1 A G 8: 70,334,080 V929A probably benign Het
Usp48 T C 4: 137,594,452 S24P probably benign Het
Vmn1r214 G A 13: 23,034,461 E42K not run Het
Vmn1r83 G T 7: 12,321,433 D232E probably benign Het
Vmn2r25 C T 6: 123,823,380 V668I probably damaging Het
Vmn2r6 A G 3: 64,556,570 I281T probably damaging Het
Ywhag A T 5: 135,911,189 Y184N probably damaging Het
Zdbf2 A C 1: 63,308,376 E1971D possibly damaging Het
Zfp568 G A 7: 30,023,414 A595T possibly damaging Het
Zfy2 T C Y: 2,117,083 D248G probably benign Het
Other mutations in Strn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Strn4 APN 7 16830452 missense probably damaging 1.00
IGL01153:Strn4 APN 7 16837921 missense probably damaging 1.00
IGL01748:Strn4 APN 7 16838302 missense probably damaging 1.00
IGL03227:Strn4 APN 7 16837714 missense possibly damaging 0.79
BB004:Strn4 UTSW 7 16826631 missense probably null 1.00
BB014:Strn4 UTSW 7 16826631 missense probably null 1.00
PIT4260001:Strn4 UTSW 7 16822509 missense probably damaging 1.00
R0948:Strn4 UTSW 7 16837713 nonsense probably null
R1876:Strn4 UTSW 7 16838282 missense probably damaging 1.00
R1918:Strn4 UTSW 7 16833921 missense probably damaging 1.00
R2015:Strn4 UTSW 7 16833028 missense possibly damaging 0.85
R2250:Strn4 UTSW 7 16826466 missense probably damaging 1.00
R3435:Strn4 UTSW 7 16837633 missense possibly damaging 0.86
R3686:Strn4 UTSW 7 16822581 missense probably damaging 1.00
R3688:Strn4 UTSW 7 16822581 missense probably damaging 1.00
R3887:Strn4 UTSW 7 16822998 unclassified probably benign
R4613:Strn4 UTSW 7 16824163 missense possibly damaging 0.50
R4730:Strn4 UTSW 7 16828794 missense possibly damaging 0.59
R5590:Strn4 UTSW 7 16833874 critical splice acceptor site probably null
R5924:Strn4 UTSW 7 16838321 missense probably damaging 1.00
R6327:Strn4 UTSW 7 16816459 missense probably benign 0.00
R6759:Strn4 UTSW 7 16823053 missense probably damaging 1.00
R6866:Strn4 UTSW 7 16828785 missense probably damaging 0.97
R6976:Strn4 UTSW 7 16830354 missense probably benign 0.20
R7779:Strn4 UTSW 7 16831492 missense probably damaging 1.00
R7927:Strn4 UTSW 7 16826631 missense probably null 1.00
R8174:Strn4 UTSW 7 16828808 missense probably damaging 1.00
R8777:Strn4 UTSW 7 16816608 missense probably damaging 1.00
R8777-TAIL:Strn4 UTSW 7 16816608 missense probably damaging 1.00
R8868:Strn4 UTSW 7 16826645 missense probably benign 0.25
R9226:Strn4 UTSW 7 16825797 intron probably benign
R9341:Strn4 UTSW 7 16839902 missense probably damaging 0.99
R9343:Strn4 UTSW 7 16839902 missense probably damaging 0.99
R9718:Strn4 UTSW 7 16838571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGTGTGAGTGCCCAGTG -3'
(R):5'- GGCTTGAGCTATCCTTGACC -3'

Sequencing Primer
(F):5'- AGTGCCCAGTGCCCACTAC -3'
(R):5'- ACCTCGGGAAGTATATCCGTC -3'
Posted On 2019-11-26