Incidental Mutation 'R7759:Or56a4'
ID 597726
Institutional Source Beutler Lab
Gene Symbol Or56a4
Ensembl Gene ENSMUSG00000047225
Gene Name olfactory receptor family 56 subfamily A member 4
Synonyms GA_x6K02T2PBJ9-7786441-7785503, Olfr684, MOR40-8P
MMRRC Submission 045815-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # R7759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 104805949-104806887 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 104806232 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 219 (S219F)
Ref Sequence ENSEMBL: ENSMUSP00000149627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060893] [ENSMUST00000215552] [ENSMUST00000215744] [ENSMUST00000217136]
AlphaFold Q7TRN8
Predicted Effect probably damaging
Transcript: ENSMUST00000060893
AA Change: S219F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055880
Gene: ENSMUSG00000047225
AA Change: S219F

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 4.6e-73 PFAM
Pfam:7TM_GPCR_Srsx 37 307 7e-8 PFAM
Pfam:7tm_1 43 294 1.7e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215552
AA Change: S219F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215744
AA Change: S219F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217136
AA Change: S219F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G T 16: 4,682,514 (GRCm39) G215V probably benign Het
Adamts1 C A 16: 85,594,683 (GRCm39) G652C probably damaging Het
Adck1 G A 12: 88,368,887 (GRCm39) A122T possibly damaging Het
Akap1 A C 11: 88,736,659 (GRCm39) M34R probably damaging Het
Apc2 C T 10: 80,147,030 (GRCm39) R695C probably damaging Het
Apon T A 10: 128,090,384 (GRCm39) W21R probably benign Het
Arhgef16 T C 4: 154,371,432 (GRCm39) T254A probably benign Het
Arid5b T A 10: 67,933,632 (GRCm39) S757C probably damaging Het
B020004C17Rik A C 14: 57,254,242 (GRCm39) I122L possibly damaging Het
Bckdhb T G 9: 83,892,379 (GRCm39) V270G probably damaging Het
Cacna1d A G 14: 29,821,145 (GRCm39) Y1146H probably benign Het
Carmil2 A G 8: 106,423,668 (GRCm39) D1214G possibly damaging Het
Ccdc142 T C 6: 83,084,912 (GRCm39) V636A probably benign Het
Chd9 T C 8: 91,704,178 (GRCm39) probably null Het
Csmd3 A G 15: 47,561,569 (GRCm39) S1336P Het
Cubn A G 2: 13,352,961 (GRCm39) Y1926H probably damaging Het
Dock4 A T 12: 40,867,735 (GRCm39) D1437V probably damaging Het
Eme1 A T 11: 94,536,666 (GRCm39) Y504* probably null Het
Enah G A 1: 181,746,009 (GRCm39) A687V unknown Het
Endou A C 15: 97,611,747 (GRCm39) V339G probably damaging Het
Ephb6 G A 6: 41,591,539 (GRCm39) R232H probably benign Het
Ephx2 G A 14: 66,326,968 (GRCm39) A409V possibly damaging Het
Esd T A 14: 74,983,007 (GRCm39) C219* probably null Het
Fscb A T 12: 64,520,866 (GRCm39) M200K probably benign Het
Gabra6 A T 11: 42,208,508 (GRCm39) V108D probably damaging Het
Gm11555 A G 11: 99,540,568 (GRCm39) V137A unknown Het
Gpld1 A G 13: 25,146,383 (GRCm39) D209G probably damaging Het
Ikzf1 T A 11: 11,719,256 (GRCm39) I408N probably damaging Het
Itgb4 A G 11: 115,894,536 (GRCm39) R1364G possibly damaging Het
Kif26b A C 1: 178,506,509 (GRCm39) K195T probably damaging Het
Mfsd12 T C 10: 81,199,427 (GRCm39) W440R probably benign Het
Mtrr C T 13: 68,718,146 (GRCm39) E373K probably damaging Het
Mug2 T A 6: 122,058,317 (GRCm39) V1293E probably damaging Het
Myof C A 19: 37,928,346 (GRCm39) A1068S probably benign Het
Ncam2 A G 16: 81,412,672 (GRCm39) D720G probably damaging Het
Nova2 G T 7: 18,692,176 (GRCm39) G435V Het
Oacyl T A 18: 65,843,631 (GRCm39) D109E probably damaging Het
Or2y1g A T 11: 49,171,463 (GRCm39) M163L probably benign Het
Pdcd11 G A 19: 47,101,637 (GRCm39) V941M possibly damaging Het
Pdzd8 C A 19: 59,288,358 (GRCm39) R1014L probably damaging Het
Ppm1h T G 10: 122,740,018 (GRCm39) D364E probably benign Het
Rigi C A 4: 40,225,104 (GRCm39) A298S probably damaging Het
Rp1 T C 1: 4,415,107 (GRCm39) N2002D probably benign Het
Sall1 C T 8: 89,768,979 (GRCm39) probably null Het
Scn10a C T 9: 119,477,198 (GRCm39) W728* probably null Het
Setdb2 G T 14: 59,656,813 (GRCm39) T168K probably damaging Het
Sgms1 T C 19: 32,137,276 (GRCm39) I97V probably benign Het
Slc8a3 A T 12: 81,361,325 (GRCm39) M498K probably benign Het
Smpd4 A T 16: 17,456,497 (GRCm39) E362D probably damaging Het
Ssc5d A T 7: 4,940,529 (GRCm39) K881* probably null Het
Strn4 A G 7: 16,564,309 (GRCm39) E313G probably damaging Het
Tas2r113 A T 6: 132,870,890 (GRCm39) N306I possibly damaging Het
Tdrd6 G T 17: 43,935,730 (GRCm39) R1773S probably benign Het
Thbs2 T C 17: 14,897,321 (GRCm39) E729G probably damaging Het
Tnfrsf23 G A 7: 143,224,572 (GRCm39) T135I probably damaging Het
Tollip A G 7: 141,438,276 (GRCm39) M218T probably benign Het
Tyk2 A T 9: 21,031,554 (GRCm39) probably null Het
Ubr2 G A 17: 47,296,974 (GRCm39) R269C probably damaging Het
Uggt1 A T 1: 36,185,806 (GRCm39) M1459K possibly damaging Het
Upf1 A G 8: 70,786,730 (GRCm39) V929A probably benign Het
Usp48 T C 4: 137,321,763 (GRCm39) S24P probably benign Het
Vmn1r214 G A 13: 23,218,631 (GRCm39) E42K not run Het
Vmn1r83 G T 7: 12,055,360 (GRCm39) D232E probably benign Het
Vmn2r25 C T 6: 123,800,339 (GRCm39) V668I probably damaging Het
Vmn2r6 A G 3: 64,463,991 (GRCm39) I281T probably damaging Het
Ywhag A T 5: 135,940,043 (GRCm39) Y184N probably damaging Het
Zdbf2 A C 1: 63,347,535 (GRCm39) E1971D possibly damaging Het
Zfp568 G A 7: 29,722,839 (GRCm39) A595T possibly damaging Het
Zfy2 T C Y: 2,117,083 (GRCm39) D248G probably benign Het
Other mutations in Or56a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Or56a4 APN 7 104,806,667 (GRCm39) missense probably benign 0.02
R0056:Or56a4 UTSW 7 104,806,329 (GRCm39) missense probably benign 0.19
R1773:Or56a4 UTSW 7 104,806,190 (GRCm39) missense probably benign 0.01
R2098:Or56a4 UTSW 7 104,806,478 (GRCm39) missense probably benign 0.03
R2295:Or56a4 UTSW 7 104,806,532 (GRCm39) missense probably benign 0.02
R3831:Or56a4 UTSW 7 104,806,589 (GRCm39) missense probably damaging 1.00
R4866:Or56a4 UTSW 7 104,806,514 (GRCm39) missense possibly damaging 0.95
R5058:Or56a4 UTSW 7 104,806,355 (GRCm39) missense probably damaging 1.00
R5504:Or56a4 UTSW 7 104,806,383 (GRCm39) missense probably benign 0.01
R7434:Or56a4 UTSW 7 104,806,106 (GRCm39) missense probably damaging 0.96
R7442:Or56a4 UTSW 7 104,806,289 (GRCm39) missense probably damaging 1.00
R7594:Or56a4 UTSW 7 104,806,880 (GRCm39) missense probably benign
R7787:Or56a4 UTSW 7 104,806,401 (GRCm39) missense probably benign 0.01
R8230:Or56a4 UTSW 7 104,806,631 (GRCm39) missense probably damaging 0.99
R8677:Or56a4 UTSW 7 104,806,775 (GRCm39) missense probably benign 0.04
R9398:Or56a4 UTSW 7 104,806,006 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAATGGGATTCAGAGCTGGG -3'
(R):5'- GCCGGAATGCCCTAATTTCTC -3'

Sequencing Primer
(F):5'- ATATTGAGCAGGATGGGGATGTCC -3'
(R):5'- GGAATGCCCTAATTTCTCTCCCAG -3'
Posted On 2019-11-26