Incidental Mutation 'R7759:Tollip'
ID597727
Institutional Source Beutler Lab
Gene Symbol Tollip
Ensembl Gene ENSMUSG00000025139
Gene Nametoll interacting protein
Synonyms4930403G24Rik, Toll interacting protein, 4931428G15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R7759 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location141874813-141918507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141884539 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 218 (M218T)
Ref Sequence ENSEMBL: ENSMUSP00000001950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001950] [ENSMUST00000055819] [ENSMUST00000130439] [ENSMUST00000151890]
Predicted Effect probably benign
Transcript: ENSMUST00000001950
AA Change: M218T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001950
Gene: ENSMUSG00000025139
AA Change: M218T

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
C2 54 151 1.32e-6 SMART
low complexity region 175 190 N/A INTRINSIC
low complexity region 213 225 N/A INTRINSIC
CUE 229 271 1.43e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055819
SMART Domains Protein: ENSMUSP00000051485
Gene: ENSMUSG00000025139

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
C2 54 151 1.32e-6 SMART
low complexity region 175 190 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000130439
AA Change: M214T
SMART Domains Protein: ENSMUSP00000117938
Gene: ENSMUSG00000025139
AA Change: M214T

DomainStartEndE-ValueType
low complexity region 24 40 N/A INTRINSIC
Pfam:C2 51 115 6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151890
AA Change: M149T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118336
Gene: ENSMUSG00000025139
AA Change: M149T

DomainStartEndE-ValueType
Pfam:C2 1 66 1.9e-8 PFAM
low complexity region 106 121 N/A INTRINSIC
low complexity region 144 156 N/A INTRINSIC
CUE 160 202 1.43e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-binding protein that interacts with several Toll-like receptor (TLR) signaling cascade components. The encoded protein regulates inflammatory signaling and is involved in interleukin-1 receptor trafficking and in the turnover of IL1R-associated kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display normal immune cell composition but reduced cytokine production when stimulated with low concentrations of some inducers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G T 16: 4,864,650 G215V probably benign Het
Adamts1 C A 16: 85,797,795 G652C probably damaging Het
Adck1 G A 12: 88,402,117 A122T possibly damaging Het
Akap1 A C 11: 88,845,833 M34R probably damaging Het
Apc2 C T 10: 80,311,196 R695C probably damaging Het
Apon T A 10: 128,254,515 W21R probably benign Het
Arhgef16 T C 4: 154,286,975 T254A probably benign Het
Arid5b T A 10: 68,097,802 S757C probably damaging Het
B020004C17Rik A C 14: 57,016,785 I122L possibly damaging Het
Bckdhb T G 9: 84,010,326 V270G probably damaging Het
Cacna1d A G 14: 30,099,188 Y1146H probably benign Het
Carmil2 A G 8: 105,697,036 D1214G possibly damaging Het
Ccdc142 T C 6: 83,107,931 V636A probably benign Het
Chd9 T C 8: 90,977,550 probably null Het
Csmd3 A G 15: 47,698,173 S1336P Het
Cubn A G 2: 13,348,150 Y1926H probably damaging Het
Ddx58 C A 4: 40,225,104 A298S probably damaging Het
Dock4 A T 12: 40,817,736 D1437V probably damaging Het
Eme1 A T 11: 94,645,840 Y504* probably null Het
Enah G A 1: 181,918,444 A687V unknown Het
Endou A C 15: 97,713,866 V339G probably damaging Het
Ephb6 G A 6: 41,614,605 R232H probably benign Het
Ephx2 G A 14: 66,089,519 A409V possibly damaging Het
Esd T A 14: 74,745,567 C219* probably null Het
Fscb A T 12: 64,474,092 M200K probably benign Het
Gabra6 A T 11: 42,317,681 V108D probably damaging Het
Gm11555 A G 11: 99,649,742 V137A unknown Het
Gpld1 A G 13: 24,962,400 D209G probably damaging Het
Ikzf1 T A 11: 11,769,256 I408N probably damaging Het
Itgb4 A G 11: 116,003,710 R1364G possibly damaging Het
Kif26b A C 1: 178,678,944 K195T probably damaging Het
Mfsd12 T C 10: 81,363,593 W440R probably benign Het
Mtrr C T 13: 68,570,027 E373K probably damaging Het
Mug2 T A 6: 122,081,358 V1293E probably damaging Het
Myof C A 19: 37,939,898 A1068S probably benign Het
Ncam2 A G 16: 81,615,784 D720G probably damaging Het
Nova2 G T 7: 18,958,251 G435V Het
Oacyl T A 18: 65,710,560 D109E probably damaging Het
Olfr1393 A T 11: 49,280,636 M163L probably benign Het
Olfr684 G A 7: 105,157,025 S219F probably damaging Het
Pdcd11 G A 19: 47,113,198 V941M possibly damaging Het
Pdzd8 C A 19: 59,299,926 R1014L probably damaging Het
Ppm1h T G 10: 122,904,113 D364E probably benign Het
Rp1 T C 1: 4,344,884 N2002D probably benign Het
Sall1 C T 8: 89,042,351 probably null Het
Scn10a C T 9: 119,648,132 W728* probably null Het
Setdb2 G T 14: 59,419,364 T168K probably damaging Het
Sgms1 T C 19: 32,159,876 I97V probably benign Het
Slc8a3 A T 12: 81,314,551 M498K probably benign Het
Smpd4 A T 16: 17,638,633 E362D probably damaging Het
Ssc5d A T 7: 4,937,530 K881* probably null Het
Strn4 A G 7: 16,830,384 E313G probably damaging Het
Tas2r113 A T 6: 132,893,927 N306I possibly damaging Het
Tdrd6 G T 17: 43,624,839 R1773S probably benign Het
Thbs2 T C 17: 14,677,059 E729G probably damaging Het
Tnfrsf23 G A 7: 143,670,835 T135I probably damaging Het
Tyk2 A T 9: 21,120,258 probably null Het
Ubr2 G A 17: 46,986,048 R269C probably damaging Het
Uggt1 A T 1: 36,146,725 M1459K possibly damaging Het
Upf1 A G 8: 70,334,080 V929A probably benign Het
Usp48 T C 4: 137,594,452 S24P probably benign Het
Vmn1r214 G A 13: 23,034,461 E42K not run Het
Vmn1r83 G T 7: 12,321,433 D232E probably benign Het
Vmn2r25 C T 6: 123,823,380 V668I probably damaging Het
Vmn2r6 A G 3: 64,556,570 I281T probably damaging Het
Ywhag A T 5: 135,911,189 Y184N probably damaging Het
Zdbf2 A C 1: 63,308,376 E1971D possibly damaging Het
Zfp568 G A 7: 30,023,414 A595T possibly damaging Het
Zfy2 T C Y: 2,117,083 D248G probably benign Het
Other mutations in Tollip
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1404:Tollip UTSW 7 141884555 missense probably benign 0.00
R1404:Tollip UTSW 7 141884555 missense probably benign 0.00
R1742:Tollip UTSW 7 141892855 missense probably damaging 1.00
R2443:Tollip UTSW 7 141890823 nonsense probably null
R4092:Tollip UTSW 7 141884443 missense probably damaging 1.00
R5192:Tollip UTSW 7 141892117 missense probably damaging 1.00
R5614:Tollip UTSW 7 141892088 missense probably damaging 1.00
R6132:Tollip UTSW 7 141889597 missense probably benign 0.37
R6805:Tollip UTSW 7 141890845 missense probably benign 0.21
R6830:Tollip UTSW 7 141898714 start codon destroyed probably null 0.00
R7366:Tollip UTSW 7 141889597 missense probably benign 0.37
R7509:Tollip UTSW 7 141892141 missense probably benign 0.36
R8024:Tollip UTSW 7 141892826 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGTGGTGTGAAGCCAAGG -3'
(R):5'- CTGCAGCTTTGTGATCCCAC -3'

Sequencing Primer
(F):5'- CAGGCGGGTCTAGGACTCTTC -3'
(R):5'- CTGGAACTCACTCTGTAGACCAGG -3'
Posted On2019-11-26