Incidental Mutation 'R7759:Tnfrsf23'
ID597728
Institutional Source Beutler Lab
Gene Symbol Tnfrsf23
Ensembl Gene ENSMUSG00000037613
Gene Nametumor necrosis factor receptor superfamily, member 23
SynonymsmSOB, mDcTrailr1, Tnfrh1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R7759 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location143665809-143685872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143670835 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 135 (T135I)
Ref Sequence ENSEMBL: ENSMUSP00000116742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035742] [ENSMUST00000152703] [ENSMUST00000208017]
Predicted Effect probably benign
Transcript: ENSMUST00000035742
SMART Domains Protein: ENSMUSP00000042431
Gene: ENSMUSG00000037613

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 38 72 1.55e-1 SMART
TNFR 75 104 3.12e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152703
AA Change: T135I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116742
Gene: ENSMUSG00000037613
AA Change: T135I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 38 72 1.55e-1 SMART
TNFR 75 114 1.29e-7 SMART
TNFR 116 155 2.14e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208017
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the tumor necrosis factor superfamily of proteins. The encoded receptor has been shown to bind to the ligand TRAIL (tumor necrosis factor-related apoptosis-inducing ligand), but to have no signaling capacity. This gene shows elevated expression in mice with diet-induced fatty liver disease. This gene and other family members are present in a gene cluster on chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G T 16: 4,864,650 G215V probably benign Het
Adamts1 C A 16: 85,797,795 G652C probably damaging Het
Adck1 G A 12: 88,402,117 A122T possibly damaging Het
Akap1 A C 11: 88,845,833 M34R probably damaging Het
Apc2 C T 10: 80,311,196 R695C probably damaging Het
Apon T A 10: 128,254,515 W21R probably benign Het
Arhgef16 T C 4: 154,286,975 T254A probably benign Het
Arid5b T A 10: 68,097,802 S757C probably damaging Het
B020004C17Rik A C 14: 57,016,785 I122L possibly damaging Het
Bckdhb T G 9: 84,010,326 V270G probably damaging Het
Cacna1d A G 14: 30,099,188 Y1146H probably benign Het
Carmil2 A G 8: 105,697,036 D1214G possibly damaging Het
Ccdc142 T C 6: 83,107,931 V636A probably benign Het
Chd9 T C 8: 90,977,550 probably null Het
Csmd3 A G 15: 47,698,173 S1336P Het
Cubn A G 2: 13,348,150 Y1926H probably damaging Het
Ddx58 C A 4: 40,225,104 A298S probably damaging Het
Dock4 A T 12: 40,817,736 D1437V probably damaging Het
Eme1 A T 11: 94,645,840 Y504* probably null Het
Enah G A 1: 181,918,444 A687V unknown Het
Endou A C 15: 97,713,866 V339G probably damaging Het
Ephb6 G A 6: 41,614,605 R232H probably benign Het
Ephx2 G A 14: 66,089,519 A409V possibly damaging Het
Esd T A 14: 74,745,567 C219* probably null Het
Fscb A T 12: 64,474,092 M200K probably benign Het
Gabra6 A T 11: 42,317,681 V108D probably damaging Het
Gm11555 A G 11: 99,649,742 V137A unknown Het
Gpld1 A G 13: 24,962,400 D209G probably damaging Het
Ikzf1 T A 11: 11,769,256 I408N probably damaging Het
Itgb4 A G 11: 116,003,710 R1364G possibly damaging Het
Kif26b A C 1: 178,678,944 K195T probably damaging Het
Mfsd12 T C 10: 81,363,593 W440R probably benign Het
Mtrr C T 13: 68,570,027 E373K probably damaging Het
Mug2 T A 6: 122,081,358 V1293E probably damaging Het
Myof C A 19: 37,939,898 A1068S probably benign Het
Ncam2 A G 16: 81,615,784 D720G probably damaging Het
Nova2 G T 7: 18,958,251 G435V Het
Oacyl T A 18: 65,710,560 D109E probably damaging Het
Olfr1393 A T 11: 49,280,636 M163L probably benign Het
Olfr684 G A 7: 105,157,025 S219F probably damaging Het
Pdcd11 G A 19: 47,113,198 V941M possibly damaging Het
Pdzd8 C A 19: 59,299,926 R1014L probably damaging Het
Ppm1h T G 10: 122,904,113 D364E probably benign Het
Rp1 T C 1: 4,344,884 N2002D probably benign Het
Sall1 C T 8: 89,042,351 probably null Het
Scn10a C T 9: 119,648,132 W728* probably null Het
Setdb2 G T 14: 59,419,364 T168K probably damaging Het
Sgms1 T C 19: 32,159,876 I97V probably benign Het
Slc8a3 A T 12: 81,314,551 M498K probably benign Het
Smpd4 A T 16: 17,638,633 E362D probably damaging Het
Ssc5d A T 7: 4,937,530 K881* probably null Het
Strn4 A G 7: 16,830,384 E313G probably damaging Het
Tas2r113 A T 6: 132,893,927 N306I possibly damaging Het
Tdrd6 G T 17: 43,624,839 R1773S probably benign Het
Thbs2 T C 17: 14,677,059 E729G probably damaging Het
Tollip A G 7: 141,884,539 M218T probably benign Het
Tyk2 A T 9: 21,120,258 probably null Het
Ubr2 G A 17: 46,986,048 R269C probably damaging Het
Uggt1 A T 1: 36,146,725 M1459K possibly damaging Het
Upf1 A G 8: 70,334,080 V929A probably benign Het
Usp48 T C 4: 137,594,452 S24P probably benign Het
Vmn1r214 G A 13: 23,034,461 E42K not run Het
Vmn1r83 G T 7: 12,321,433 D232E probably benign Het
Vmn2r25 C T 6: 123,823,380 V668I probably damaging Het
Vmn2r6 A G 3: 64,556,570 I281T probably damaging Het
Ywhag A T 5: 135,911,189 Y184N probably damaging Het
Zdbf2 A C 1: 63,308,376 E1971D possibly damaging Het
Zfp568 G A 7: 30,023,414 A595T possibly damaging Het
Zfy2 T C Y: 2,117,083 D248G probably benign Het
Other mutations in Tnfrsf23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Tnfrsf23 APN 7 143679999 missense probably damaging 0.99
IGL02409:Tnfrsf23 APN 7 143668571 missense probably damaging 0.98
R1936:Tnfrsf23 UTSW 7 143668554 missense probably benign 0.04
R3840:Tnfrsf23 UTSW 7 143681529 missense probably benign 0.09
R4201:Tnfrsf23 UTSW 7 143670054 missense probably damaging 1.00
R4786:Tnfrsf23 UTSW 7 143680064 missense probably damaging 1.00
R4858:Tnfrsf23 UTSW 7 143681480 missense probably damaging 1.00
R5226:Tnfrsf23 UTSW 7 143685785 missense possibly damaging 0.68
R7687:Tnfrsf23 UTSW 7 143681462 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TCAAGGGACATTAGCCATGG -3'
(R):5'- TGTGAAGGTTTACCAGGACAC -3'

Sequencing Primer
(F):5'- GGACATTAGCCATGGAGATCTC -3'
(R):5'- AGGTTTACCAGGACACACTGTGTTC -3'
Posted On2019-11-26