Mutagenetix > Incidental Mutation

Incidental Mutation 'R7759:Sall1'

597730

Institutional Source

Beutler Lab

Gene Symbol

Sall1

Ensembl Gene

ENSMUSG00000031665

Gene Name

spalt like transcription factor 1

Synonyms

Msal-3

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.950) question?

Stock #

R7759 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

89027235-89044162 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 89042351 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000034090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034090]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000034090

SMART Domains

Protein: ENSMUSP00000034090
Gene: ENSMUSG00000031665

Domain	Start	End	E-Value	Type
low complexity region	133	152	N/A	INTRINSIC
low complexity region	163	175	N/A	INTRINSIC
low complexity region	229	257	N/A	INTRINSIC
low complexity region	283	309	N/A	INTRINSIC
low complexity region	361	396	N/A	INTRINSIC
ZnF_C2H2	450	472	2.57e-3	SMART
ZnF_C2H2	478	500	3.21e-4	SMART
low complexity region	547	569	N/A	INTRINSIC
ZnF_C2H2	705	727	3.02e0	SMART
ZnF_C2H2	733	755	8.6e-5	SMART
ZnF_C2H2	765	787	1.6e-4	SMART
low complexity region	842	861	N/A	INTRINSIC
ZnF_C2H2	1000	1022	2.91e-2	SMART
ZnF_C2H2	1028	1050	4.94e-5	SMART
ZnF_C2H2	1133	1155	1.38e-3	SMART
ZnF_C2H2	1161	1183	1.22e-4	SMART
low complexity region	1257	1277	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcriptional repressor and may be part of the NuRD histone deacetylase complex (HDAC). Defects in this gene are a cause of Townes-Brocks syndrome (TBS) as well as bronchio-oto-renal syndrome (BOR). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit kidney agenesis or dysgenesis and die perinatally. Homozygotes expressing only a truncated protein show renal agenesis, exencephaly, and limb defects; heterozygotes have hearing loss and cystic kidneys. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	G	T	16: 4,864,650	G215V	probably benign	Het
Adamts1	C	A	16: 85,797,795	G652C	probably damaging	Het
Adck1	G	A	12: 88,402,117	A122T	possibly damaging	Het
Akap1	A	C	11: 88,845,833	M34R	probably damaging	Het
Apc2	C	T	10: 80,311,196	R695C	probably damaging	Het
Apon	T	A	10: 128,254,515	W21R	probably benign	Het
Arhgef16	T	C	4: 154,286,975	T254A	probably benign	Het
Arid5b	T	A	10: 68,097,802	S757C	probably damaging	Het
B020004C17Rik	A	C	14: 57,016,785	I122L	possibly damaging	Het
Bckdhb	T	G	9: 84,010,326	V270G	probably damaging	Het
Cacna1d	A	G	14: 30,099,188	Y1146H	probably benign	Het
Carmil2	A	G	8: 105,697,036	D1214G	possibly damaging	Het
Ccdc142	T	C	6: 83,107,931	V636A	probably benign	Het
Chd9	T	C	8: 90,977,550		probably null	Het
Csmd3	A	G	15: 47,698,173	S1336P		Het
Cubn	A	G	2: 13,348,150	Y1926H	probably damaging	Het
Ddx58	C	A	4: 40,225,104	A298S	probably damaging	Het
Dock4	A	T	12: 40,817,736	D1437V	probably damaging	Het
Eme1	A	T	11: 94,645,840	Y504*	probably null	Het
Enah	G	A	1: 181,918,444	A687V	unknown	Het
Endou	A	C	15: 97,713,866	V339G	probably damaging	Het
Ephb6	G	A	6: 41,614,605	R232H	probably benign	Het
Ephx2	G	A	14: 66,089,519	A409V	possibly damaging	Het
Esd	T	A	14: 74,745,567	C219*	probably null	Het
Fscb	A	T	12: 64,474,092	M200K	probably benign	Het
Gabra6	A	T	11: 42,317,681	V108D	probably damaging	Het
Gm11555	A	G	11: 99,649,742	V137A	unknown	Het
Gpld1	A	G	13: 24,962,400	D209G	probably damaging	Het
Ikzf1	T	A	11: 11,769,256	I408N	probably damaging	Het
Itgb4	A	G	11: 116,003,710	R1364G	possibly damaging	Het
Kif26b	A	C	1: 178,678,944	K195T	probably damaging	Het
Mfsd12	T	C	10: 81,363,593	W440R	probably benign	Het
Mtrr	C	T	13: 68,570,027	E373K	probably damaging	Het
Mug2	T	A	6: 122,081,358	V1293E	probably damaging	Het
Myof	C	A	19: 37,939,898	A1068S	probably benign	Het
Ncam2	A	G	16: 81,615,784	D720G	probably damaging	Het
Nova2	G	T	7: 18,958,251	G435V		Het
Oacyl	T	A	18: 65,710,560	D109E	probably damaging	Het
Olfr1393	A	T	11: 49,280,636	M163L	probably benign	Het
Olfr684	G	A	7: 105,157,025	S219F	probably damaging	Het
Pdcd11	G	A	19: 47,113,198	V941M	possibly damaging	Het
Pdzd8	C	A	19: 59,299,926	R1014L	probably damaging	Het
Ppm1h	T	G	10: 122,904,113	D364E	probably benign	Het
Rp1	T	C	1: 4,344,884	N2002D	probably benign	Het
Scn10a	C	T	9: 119,648,132	W728*	probably null	Het
Setdb2	G	T	14: 59,419,364	T168K	probably damaging	Het
Sgms1	T	C	19: 32,159,876	I97V	probably benign	Het
Slc8a3	A	T	12: 81,314,551	M498K	probably benign	Het
Smpd4	A	T	16: 17,638,633	E362D	probably damaging	Het
Ssc5d	A	T	7: 4,937,530	K881*	probably null	Het
Strn4	A	G	7: 16,830,384	E313G	probably damaging	Het
Tas2r113	A	T	6: 132,893,927	N306I	possibly damaging	Het
Tdrd6	G	T	17: 43,624,839	R1773S	probably benign	Het
Thbs2	T	C	17: 14,677,059	E729G	probably damaging	Het
Tnfrsf23	G	A	7: 143,670,835	T135I	probably damaging	Het
Tollip	A	G	7: 141,884,539	M218T	probably benign	Het
Tyk2	A	T	9: 21,120,258		probably null	Het
Ubr2	G	A	17: 46,986,048	R269C	probably damaging	Het
Uggt1	A	T	1: 36,146,725	M1459K	possibly damaging	Het
Upf1	A	G	8: 70,334,080	V929A	probably benign	Het
Usp48	T	C	4: 137,594,452	S24P	probably benign	Het
Vmn1r214	G	A	13: 23,034,461	E42K	not run	Het
Vmn1r83	G	T	7: 12,321,433	D232E	probably benign	Het
Vmn2r25	C	T	6: 123,823,380	V668I	probably damaging	Het
Vmn2r6	A	G	3: 64,556,570	I281T	probably damaging	Het
Ywhag	A	T	5: 135,911,189	Y184N	probably damaging	Het
Zdbf2	A	C	1: 63,308,376	E1971D	possibly damaging	Het
Zfp568	G	A	7: 30,023,414	A595T	possibly damaging	Het
Zfy2	T	C	Y: 2,117,083	D248G	probably benign	Het

Other mutations in Sall1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01062:Sall1	APN	8	89033344	missense	probably damaging	1.00
IGL01670:Sall1	APN	8	89031571	missense	probably benign	0.01
IGL01795:Sall1	APN	8	89028680	missense	probably benign	0.02
IGL02041:Sall1	APN	8	89031469	missense	probably damaging	1.00
IGL02078:Sall1	APN	8	89030375	missense	probably damaging	0.99
IGL02105:Sall1	APN	8	89032568	missense	probably damaging	0.99
IGL02354:Sall1	APN	8	89033049	missense	probably benign	0.10
IGL02727:Sall1	APN	8	89030755	missense	probably damaging	1.00
IGL02943:Sall1	APN	8	89031121	missense	probably damaging	0.99
IGL03179:Sall1	APN	8	89031661	missense	probably benign	0.00
PIT4651001:Sall1	UTSW	8	89031103	missense	probably damaging	1.00
R0089:Sall1	UTSW	8	89030268	missense	probably benign	0.09
R0386:Sall1	UTSW	8	89032604	missense	probably damaging	1.00
R0532:Sall1	UTSW	8	89033191	missense	probably benign
R0555:Sall1	UTSW	8	89031758	missense	probably benign	0.16
R1203:Sall1	UTSW	8	89031934	missense	probably damaging	1.00
R1406:Sall1	UTSW	8	89032444	missense	probably benign	0.34
R1406:Sall1	UTSW	8	89032444	missense	probably benign	0.34
R1449:Sall1	UTSW	8	89032483	missense	probably benign
R1477:Sall1	UTSW	8	89032882	missense	probably damaging	1.00
R1692:Sall1	UTSW	8	89028400	missense	probably benign	0.00
R1839:Sall1	UTSW	8	89028716	missense	possibly damaging	0.89
R2016:Sall1	UTSW	8	89028409	missense	probably benign	0.10
R2041:Sall1	UTSW	8	89032801	missense	probably benign
R3808:Sall1	UTSW	8	89031473	nonsense	probably null
R3816:Sall1	UTSW	8	89032675	missense	probably benign	0.00
R4085:Sall1	UTSW	8	89028509	missense	probably benign
R4604:Sall1	UTSW	8	89030341	missense	probably damaging	1.00
R4701:Sall1	UTSW	8	89031160	missense	probably damaging	1.00
R5760:Sall1	UTSW	8	89028650	missense	possibly damaging	0.94
R6091:Sall1	UTSW	8	89028619	missense	probably damaging	1.00
R6213:Sall1	UTSW	8	89033058	small deletion	probably benign
R6326:Sall1	UTSW	8	89030268	missense	probably benign	0.09
R6920:Sall1	UTSW	8	89030393	missense	probably damaging	1.00
R6954:Sall1	UTSW	8	89032891	missense	probably damaging	1.00
R7395:Sall1	UTSW	8	89030921	missense	possibly damaging	0.86
R7396:Sall1	UTSW	8	89032768	missense	probably damaging	1.00
R7493:Sall1	UTSW	8	89031053	missense	probably benign	0.32
R7555:Sall1	UTSW	8	89033158	missense	possibly damaging	0.90
R7672:Sall1	UTSW	8	89031299	missense	probably damaging	0.99
R7834:Sall1	UTSW	8	89033374	missense	probably benign	0.42
R8023:Sall1	UTSW	8	89032543	missense	probably damaging	0.99
R8166:Sall1	UTSW	8	89028518	missense	probably benign	0.27
R8708:Sall1	UTSW	8	89032855	missense	probably damaging	1.00
R9653:Sall1	UTSW	8	89030878	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTCTTTAACGTTGGCCGCAG -3'
(R):5'- TTATAGCAGGACACATGCGCG -3'

Sequencing Primer
(F):5'- CAGTCGAGGACACGGAACTC -3'
(R):5'- GACACATGCGCGCTGTG -3'

Posted On

2019-11-26