Mutagenetix > Incidental Mutation

Incidental Mutation 'R7759:Tyk2'

597733

Institutional Source

Beutler Lab

Gene Symbol

Tyk2

Ensembl Gene

ENSMUSG00000032175

Gene Name

tyrosine kinase 2

Synonyms

JTK1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7759 (G1)

Quality Score

178.009

Status

Not validated

Chromosome

Chromosomal Location

21104068-21131243 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 21120258 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000150354 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001036] [ENSMUST00000214454] [ENSMUST00000214864] [ENSMUST00000216874]

AlphaFold

Q9R117

Predicted Effect

probably null
Transcript: ENSMUST00000001036

SMART Domains

Protein: ENSMUSP00000001036
Gene: ENSMUSG00000032175

Domain	Start	End	E-Value	Type
B41	29	301	1.51e-26	SMART
Blast:B41	408	460	3e-12	BLAST
SH2	470	562	1.26e-2	SMART
STYKc	612	886	8.89e-15	SMART
TyrKc	917	1189	6.48e-114	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000214454

Predicted Effect

probably benign
Transcript: ENSMUST00000214864

Predicted Effect

probably null
Transcript: ENSMUST00000216874

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tyrosine kinase and, more specifically, the Janus kinases (JAKs) protein families. This protein associates with the cytoplasmic domain of type I and type II cytokine receptors and promulgate cytokine signals by phosphorylating receptor subunits. It is also component of both the type I and type III interferon signaling pathways. As such, it may play a role in anti-viral immunity. A mutation in this gene has been associated with hyperimmunoglobulin E syndrome (HIES) - a primary immunodeficiency characterized by elevated serum immunoglobulin E. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile, but differ from wild-type with respect to interleukin 12 mediated T cell function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	G	T	16: 4,864,650	G215V	probably benign	Het
Adamts1	C	A	16: 85,797,795	G652C	probably damaging	Het
Adck1	G	A	12: 88,402,117	A122T	possibly damaging	Het
Akap1	A	C	11: 88,845,833	M34R	probably damaging	Het
Apc2	C	T	10: 80,311,196	R695C	probably damaging	Het
Apon	T	A	10: 128,254,515	W21R	probably benign	Het
Arhgef16	T	C	4: 154,286,975	T254A	probably benign	Het
Arid5b	T	A	10: 68,097,802	S757C	probably damaging	Het
B020004C17Rik	A	C	14: 57,016,785	I122L	possibly damaging	Het
Bckdhb	T	G	9: 84,010,326	V270G	probably damaging	Het
Cacna1d	A	G	14: 30,099,188	Y1146H	probably benign	Het
Carmil2	A	G	8: 105,697,036	D1214G	possibly damaging	Het
Ccdc142	T	C	6: 83,107,931	V636A	probably benign	Het
Chd9	T	C	8: 90,977,550		probably null	Het
Csmd3	A	G	15: 47,698,173	S1336P		Het
Cubn	A	G	2: 13,348,150	Y1926H	probably damaging	Het
Ddx58	C	A	4: 40,225,104	A298S	probably damaging	Het
Dock4	A	T	12: 40,817,736	D1437V	probably damaging	Het
Eme1	A	T	11: 94,645,840	Y504*	probably null	Het
Enah	G	A	1: 181,918,444	A687V	unknown	Het
Endou	A	C	15: 97,713,866	V339G	probably damaging	Het
Ephb6	G	A	6: 41,614,605	R232H	probably benign	Het
Ephx2	G	A	14: 66,089,519	A409V	possibly damaging	Het
Esd	T	A	14: 74,745,567	C219*	probably null	Het
Fscb	A	T	12: 64,474,092	M200K	probably benign	Het
Gabra6	A	T	11: 42,317,681	V108D	probably damaging	Het
Gm11555	A	G	11: 99,649,742	V137A	unknown	Het
Gpld1	A	G	13: 24,962,400	D209G	probably damaging	Het
Ikzf1	T	A	11: 11,769,256	I408N	probably damaging	Het
Itgb4	A	G	11: 116,003,710	R1364G	possibly damaging	Het
Kif26b	A	C	1: 178,678,944	K195T	probably damaging	Het
Mfsd12	T	C	10: 81,363,593	W440R	probably benign	Het
Mtrr	C	T	13: 68,570,027	E373K	probably damaging	Het
Mug2	T	A	6: 122,081,358	V1293E	probably damaging	Het
Myof	C	A	19: 37,939,898	A1068S	probably benign	Het
Ncam2	A	G	16: 81,615,784	D720G	probably damaging	Het
Nova2	G	T	7: 18,958,251	G435V		Het
Oacyl	T	A	18: 65,710,560	D109E	probably damaging	Het
Olfr1393	A	T	11: 49,280,636	M163L	probably benign	Het
Olfr684	G	A	7: 105,157,025	S219F	probably damaging	Het
Pdcd11	G	A	19: 47,113,198	V941M	possibly damaging	Het
Pdzd8	C	A	19: 59,299,926	R1014L	probably damaging	Het
Ppm1h	T	G	10: 122,904,113	D364E	probably benign	Het
Rp1	T	C	1: 4,344,884	N2002D	probably benign	Het
Sall1	C	T	8: 89,042,351		probably null	Het
Scn10a	C	T	9: 119,648,132	W728*	probably null	Het
Setdb2	G	T	14: 59,419,364	T168K	probably damaging	Het
Sgms1	T	C	19: 32,159,876	I97V	probably benign	Het
Slc8a3	A	T	12: 81,314,551	M498K	probably benign	Het
Smpd4	A	T	16: 17,638,633	E362D	probably damaging	Het
Ssc5d	A	T	7: 4,937,530	K881*	probably null	Het
Strn4	A	G	7: 16,830,384	E313G	probably damaging	Het
Tas2r113	A	T	6: 132,893,927	N306I	possibly damaging	Het
Tdrd6	G	T	17: 43,624,839	R1773S	probably benign	Het
Thbs2	T	C	17: 14,677,059	E729G	probably damaging	Het
Tnfrsf23	G	A	7: 143,670,835	T135I	probably damaging	Het
Tollip	A	G	7: 141,884,539	M218T	probably benign	Het
Ubr2	G	A	17: 46,986,048	R269C	probably damaging	Het
Uggt1	A	T	1: 36,146,725	M1459K	possibly damaging	Het
Upf1	A	G	8: 70,334,080	V929A	probably benign	Het
Usp48	T	C	4: 137,594,452	S24P	probably benign	Het
Vmn1r214	G	A	13: 23,034,461	E42K	not run	Het
Vmn1r83	G	T	7: 12,321,433	D232E	probably benign	Het
Vmn2r25	C	T	6: 123,823,380	V668I	probably damaging	Het
Vmn2r6	A	G	3: 64,556,570	I281T	probably damaging	Het
Ywhag	A	T	5: 135,911,189	Y184N	probably damaging	Het
Zdbf2	A	C	1: 63,308,376	E1971D	possibly damaging	Het
Zfp568	G	A	7: 30,023,414	A595T	possibly damaging	Het
Zfy2	T	C	Y: 2,117,083	D248G	probably benign	Het

Other mutations in Tyk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00980:Tyk2	APN	9	21120588	missense	probably benign	0.27
IGL01015:Tyk2	APN	9	21120700	missense	probably benign	0.00
IGL01096:Tyk2	APN	9	21108863	missense	probably damaging	1.00
IGL01410:Tyk2	APN	9	21109364	missense	probably damaging	1.00
IGL01613:Tyk2	APN	9	21120576	missense	probably damaging	0.99
IGL01997:Tyk2	APN	9	21110494	missense	probably damaging	1.00
IGL02249:Tyk2	APN	9	21120407	missense	probably damaging	1.00
IGL02407:Tyk2	APN	9	21109227	splice site	probably benign
IGL02538:Tyk2	APN	9	21111043	missense	possibly damaging	0.94
IGL03185:Tyk2	APN	9	21109384	missense	probably damaging	1.00
conspiracy	UTSW	9	21108776	nonsense	probably null
fringe	UTSW	9	21108860	missense	probably benign	0.35
leonard	UTSW	9	21127120	splice site	probably benign
motorbike	UTSW	9	21105107	missense	probably damaging	1.00
tyke	UTSW	9	21124954	missense	probably damaging	1.00
ANU74:Tyk2	UTSW	9	21116158	missense	probably damaging	1.00
R0355:Tyk2	UTSW	9	21114190	splice site	probably null
R0667:Tyk2	UTSW	9	21108871	missense	probably damaging	1.00
R0862:Tyk2	UTSW	9	21116167	missense	probably benign	0.00
R0883:Tyk2	UTSW	9	21111137	missense	possibly damaging	0.61
R1554:Tyk2	UTSW	9	21107922	missense	probably damaging	0.96
R1575:Tyk2	UTSW	9	21115462	missense	probably benign	0.00
R1664:Tyk2	UTSW	9	21120353	missense	probably damaging	1.00
R1676:Tyk2	UTSW	9	21115249	nonsense	probably null
R1843:Tyk2	UTSW	9	21121554	nonsense	probably null
R1871:Tyk2	UTSW	9	21121441	missense	probably damaging	1.00
R2044:Tyk2	UTSW	9	21120341	missense	probably damaging	1.00
R2137:Tyk2	UTSW	9	21110985	intron	probably benign
R2197:Tyk2	UTSW	9	21115207	missense	probably damaging	1.00
R2883:Tyk2	UTSW	9	21110587	missense	probably benign	0.01
R2941:Tyk2	UTSW	9	21111119	missense	probably benign	0.00
R3001:Tyk2	UTSW	9	21109321	missense	probably benign	0.00
R3002:Tyk2	UTSW	9	21109321	missense	probably benign	0.00
R3196:Tyk2	UTSW	9	21124032	missense	possibly damaging	0.80
R3622:Tyk2	UTSW	9	21127310	missense	probably damaging	0.98
R4024:Tyk2	UTSW	9	21115919	missense	probably damaging	1.00
R4459:Tyk2	UTSW	9	21124415	missense	probably damaging	1.00
R4604:Tyk2	UTSW	9	21108009	missense	probably damaging	1.00
R4664:Tyk2	UTSW	9	21114207	missense	probably damaging	0.99
R4666:Tyk2	UTSW	9	21114207	missense	probably damaging	0.99
R4915:Tyk2	UTSW	9	21111137	missense	probably benign	0.41
R4971:Tyk2	UTSW	9	21120501	critical splice donor site	probably null
R5014:Tyk2	UTSW	9	21115830	splice site	probably null
R5191:Tyk2	UTSW	9	21107497	missense	probably damaging	0.98
R5305:Tyk2	UTSW	9	21109381	missense	probably damaging	0.99
R5356:Tyk2	UTSW	9	21115744	missense	probably benign	0.03
R5501:Tyk2	UTSW	9	21121612	missense	probably damaging	1.00
R6025:Tyk2	UTSW	9	21115960	missense	probably benign	0.05
R6113:Tyk2	UTSW	9	21107922	missense	probably damaging	1.00
R6159:Tyk2	UTSW	9	21110504	missense	probably damaging	0.99
R6608:Tyk2	UTSW	9	21108016	missense	probably benign	0.02
R6610:Tyk2	UTSW	9	21108016	missense	probably benign	0.02
R6612:Tyk2	UTSW	9	21108016	missense	probably benign	0.02
R6870:Tyk2	UTSW	9	21124954	missense	probably damaging	1.00
R7216:Tyk2	UTSW	9	21120526	missense	probably benign	0.01
R7218:Tyk2	UTSW	9	21105054	missense	probably damaging	1.00
R7298:Tyk2	UTSW	9	21108860	missense	probably benign	0.35
R7322:Tyk2	UTSW	9	21110204	missense	probably benign
R7347:Tyk2	UTSW	9	21108034	missense	probably damaging	0.99
R7840:Tyk2	UTSW	9	21124967	missense	probably damaging	1.00
R7854:Tyk2	UTSW	9	21115480	missense	probably benign
R7914:Tyk2	UTSW	9	21121555	missense	probably benign	0.01
R8312:Tyk2	UTSW	9	21115649	missense	possibly damaging	0.69
R8892:Tyk2	UTSW	9	21116167	missense	probably benign	0.00
R8934:Tyk2	UTSW	9	21127120	splice site	probably benign
R9013:Tyk2	UTSW	9	21105107	missense	probably damaging	1.00
R9091:Tyk2	UTSW	9	21124545	missense	probably damaging	1.00
R9097:Tyk2	UTSW	9	21108776	nonsense	probably null
R9104:Tyk2	UTSW	9	21115466	missense	possibly damaging	0.65
R9270:Tyk2	UTSW	9	21124545	missense	probably damaging	1.00
Z1177:Tyk2	UTSW	9	21105367	missense	probably benign
Z1177:Tyk2	UTSW	9	21108875	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACAGCTAGACACTCGGTG -3'
(R):5'- AACAAGTGCTTGGTGGGAGC -3'

Sequencing Primer
(F):5'- CTAGACACTCGGTGGGCAAG -3'
(R):5'- ATGAGTCCTGCTGAGCGC -3'

Posted On

2019-11-26