Incidental Mutation 'R7759:Scn10a'
ID597735
Institutional Source Beutler Lab
Gene Symbol Scn10a
Ensembl Gene ENSMUSG00000034533
Gene Namesodium channel, voltage-gated, type X, alpha
SynonymsNav1.8
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R7759 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location119608456-119719322 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 119648132 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 728 (W728*)
Ref Sequence ENSEMBL: ENSMUSP00000148987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084787] [ENSMUST00000213392] [ENSMUST00000214408]
Predicted Effect probably null
Transcript: ENSMUST00000084787
AA Change: W728*
SMART Domains Protein: ENSMUSP00000081845
Gene: ENSMUSG00000034533
AA Change: W728*

DomainStartEndE-ValueType
Pfam:Ion_trans 129 406 7.9e-77 PFAM
low complexity region 557 572 N/A INTRINSIC
Pfam:Ion_trans 663 898 6.8e-53 PFAM
Pfam:Na_trans_assoc 903 1148 2.7e-57 PFAM
Pfam:Ion_trans 1152 1429 8.1e-66 PFAM
Pfam:Ion_trans 1476 1734 1.9e-55 PFAM
Pfam:PKD_channel 1561 1729 3.4e-8 PFAM
IQ 1851 1873 7.57e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000213392
AA Change: W728*
Predicted Effect probably null
Transcript: ENSMUST00000214408
AA Change: W728*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tetrodotoxin-resistant voltage-gated sodium channel alpha subunit. The properties of the channel formed by the encoded transmembrane protein can be altered by interaction with different beta subunits. This protein may be involved in the onset of pain associated with peripheral neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired perception of pain. Mice homozygous or heterozygous for an ENU-induced allele exhibit a catalepsy phenotype following scruffing and increased sensitivity to cold pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G T 16: 4,864,650 G215V probably benign Het
Adamts1 C A 16: 85,797,795 G652C probably damaging Het
Adck1 G A 12: 88,402,117 A122T possibly damaging Het
Akap1 A C 11: 88,845,833 M34R probably damaging Het
Apc2 C T 10: 80,311,196 R695C probably damaging Het
Apon T A 10: 128,254,515 W21R probably benign Het
Arhgef16 T C 4: 154,286,975 T254A probably benign Het
Arid5b T A 10: 68,097,802 S757C probably damaging Het
B020004C17Rik A C 14: 57,016,785 I122L possibly damaging Het
Bckdhb T G 9: 84,010,326 V270G probably damaging Het
Cacna1d A G 14: 30,099,188 Y1146H probably benign Het
Carmil2 A G 8: 105,697,036 D1214G possibly damaging Het
Ccdc142 T C 6: 83,107,931 V636A probably benign Het
Chd9 T C 8: 90,977,550 probably null Het
Csmd3 A G 15: 47,698,173 S1336P Het
Cubn A G 2: 13,348,150 Y1926H probably damaging Het
Ddx58 C A 4: 40,225,104 A298S probably damaging Het
Dock4 A T 12: 40,817,736 D1437V probably damaging Het
Eme1 A T 11: 94,645,840 Y504* probably null Het
Enah G A 1: 181,918,444 A687V unknown Het
Endou A C 15: 97,713,866 V339G probably damaging Het
Ephb6 G A 6: 41,614,605 R232H probably benign Het
Ephx2 G A 14: 66,089,519 A409V possibly damaging Het
Esd T A 14: 74,745,567 C219* probably null Het
Fscb A T 12: 64,474,092 M200K probably benign Het
Gabra6 A T 11: 42,317,681 V108D probably damaging Het
Gm11555 A G 11: 99,649,742 V137A unknown Het
Gpld1 A G 13: 24,962,400 D209G probably damaging Het
Ikzf1 T A 11: 11,769,256 I408N probably damaging Het
Itgb4 A G 11: 116,003,710 R1364G possibly damaging Het
Kif26b A C 1: 178,678,944 K195T probably damaging Het
Mfsd12 T C 10: 81,363,593 W440R probably benign Het
Mtrr C T 13: 68,570,027 E373K probably damaging Het
Mug2 T A 6: 122,081,358 V1293E probably damaging Het
Myof C A 19: 37,939,898 A1068S probably benign Het
Ncam2 A G 16: 81,615,784 D720G probably damaging Het
Nova2 G T 7: 18,958,251 G435V Het
Oacyl T A 18: 65,710,560 D109E probably damaging Het
Olfr1393 A T 11: 49,280,636 M163L probably benign Het
Olfr684 G A 7: 105,157,025 S219F probably damaging Het
Pdcd11 G A 19: 47,113,198 V941M possibly damaging Het
Pdzd8 C A 19: 59,299,926 R1014L probably damaging Het
Ppm1h T G 10: 122,904,113 D364E probably benign Het
Rp1 T C 1: 4,344,884 N2002D probably benign Het
Sall1 C T 8: 89,042,351 probably null Het
Setdb2 G T 14: 59,419,364 T168K probably damaging Het
Sgms1 T C 19: 32,159,876 I97V probably benign Het
Slc8a3 A T 12: 81,314,551 M498K probably benign Het
Smpd4 A T 16: 17,638,633 E362D probably damaging Het
Ssc5d A T 7: 4,937,530 K881* probably null Het
Strn4 A G 7: 16,830,384 E313G probably damaging Het
Tas2r113 A T 6: 132,893,927 N306I possibly damaging Het
Tdrd6 G T 17: 43,624,839 R1773S probably benign Het
Thbs2 T C 17: 14,677,059 E729G probably damaging Het
Tnfrsf23 G A 7: 143,670,835 T135I probably damaging Het
Tollip A G 7: 141,884,539 M218T probably benign Het
Tyk2 A T 9: 21,120,258 probably null Het
Ubr2 G A 17: 46,986,048 R269C probably damaging Het
Uggt1 A T 1: 36,146,725 M1459K possibly damaging Het
Upf1 A G 8: 70,334,080 V929A probably benign Het
Usp48 T C 4: 137,594,452 S24P probably benign Het
Vmn1r214 G A 13: 23,034,461 E42K not run Het
Vmn1r83 G T 7: 12,321,433 D232E probably benign Het
Vmn2r25 C T 6: 123,823,380 V668I probably damaging Het
Vmn2r6 A G 3: 64,556,570 I281T probably damaging Het
Ywhag A T 5: 135,911,189 Y184N probably damaging Het
Zdbf2 A C 1: 63,308,376 E1971D possibly damaging Het
Zfp568 G A 7: 30,023,414 A595T possibly damaging Het
Zfy2 T C Y: 2,117,083 D248G probably benign Het
Other mutations in Scn10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn10a APN 9 119672226 missense probably damaging 1.00
IGL01339:Scn10a APN 9 119622766 missense probably damaging 1.00
IGL01467:Scn10a APN 9 119658412 missense probably benign 0.33
IGL01472:Scn10a APN 9 119617763 missense probably damaging 1.00
IGL01481:Scn10a APN 9 119609194 missense probably damaging 1.00
IGL01539:Scn10a APN 9 119638698 missense probably damaging 0.99
IGL01580:Scn10a APN 9 119627159 missense probably damaging 1.00
IGL01676:Scn10a APN 9 119672165 nonsense probably null
IGL01681:Scn10a APN 9 119694077 missense probably damaging 1.00
IGL01748:Scn10a APN 9 119627084 missense probably damaging 1.00
IGL01866:Scn10a APN 9 119635502 nonsense probably null
IGL01998:Scn10a APN 9 119609676 missense probably damaging 1.00
IGL02015:Scn10a APN 9 119664951 missense probably benign 0.09
IGL02098:Scn10a APN 9 119691478 missense possibly damaging 0.90
IGL02113:Scn10a APN 9 119609890 missense probably damaging 1.00
IGL02245:Scn10a APN 9 119672152 missense probably damaging 1.00
IGL02262:Scn10a APN 9 119658433 missense possibly damaging 0.92
IGL02317:Scn10a APN 9 119638555 missense probably benign 0.00
IGL02428:Scn10a APN 9 119691562 missense probably damaging 1.00
IGL02439:Scn10a APN 9 119618848 missense probably benign 0.40
IGL02583:Scn10a APN 9 119691440 splice site probably benign
IGL02597:Scn10a APN 9 119610123 missense probably damaging 0.99
IGL02680:Scn10a APN 9 119666059 missense probably damaging 1.00
IGL02733:Scn10a APN 9 119616705 missense probably damaging 1.00
IGL02851:Scn10a APN 9 119671608 missense probably damaging 1.00
IGL02992:Scn10a APN 9 119609560 missense possibly damaging 0.90
IGL03040:Scn10a APN 9 119622985 missense probably damaging 1.00
IGL03049:Scn10a APN 9 119665990 missense probably damaging 1.00
IGL03407:Scn10a APN 9 119648171 missense probably damaging 0.99
possum UTSW 9 119638705 missense probably damaging 1.00
R0025:Scn10a UTSW 9 119670484 missense probably damaging 1.00
R0030:Scn10a UTSW 9 119669990 missense probably benign 0.01
R0328:Scn10a UTSW 9 119694102 missense possibly damaging 0.92
R0494:Scn10a UTSW 9 119624100 missense probably damaging 1.00
R0511:Scn10a UTSW 9 119613700 missense probably damaging 0.99
R0548:Scn10a UTSW 9 119665928 missense probably benign 0.00
R0584:Scn10a UTSW 9 119670531 missense probably damaging 1.00
R0595:Scn10a UTSW 9 119666063 missense probably benign 0.01
R0894:Scn10a UTSW 9 119630147 missense probably damaging 1.00
R1022:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1024:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1263:Scn10a UTSW 9 119617733 missense probably damaging 1.00
R1456:Scn10a UTSW 9 119691478 missense probably benign 0.01
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1573:Scn10a UTSW 9 119613626 missense probably benign 0.04
R1704:Scn10a UTSW 9 119609394 missense probably damaging 1.00
R1933:Scn10a UTSW 9 119609998 missense probably damaging 1.00
R1945:Scn10a UTSW 9 119691454 missense possibly damaging 0.91
R2013:Scn10a UTSW 9 119613736 missense probably damaging 0.99
R2155:Scn10a UTSW 9 119609448 missense probably benign 0.02
R2196:Scn10a UTSW 9 119609004 missense probably benign
R2231:Scn10a UTSW 9 119633850 missense possibly damaging 0.73
R2353:Scn10a UTSW 9 119638687 missense probably damaging 1.00
R2392:Scn10a UTSW 9 119627202 missense possibly damaging 0.86
R2895:Scn10a UTSW 9 119661401 missense probably benign 0.00
R2926:Scn10a UTSW 9 119638701 missense possibly damaging 0.93
R3783:Scn10a UTSW 9 119691562 missense probably damaging 1.00
R3821:Scn10a UTSW 9 119638633 missense probably benign
R4003:Scn10a UTSW 9 119608968 missense probably null 0.00
R4208:Scn10a UTSW 9 119616776 missense probably damaging 0.99
R4231:Scn10a UTSW 9 119631544 missense probably damaging 0.98
R4626:Scn10a UTSW 9 119631505 missense possibly damaging 0.87
R4702:Scn10a UTSW 9 119633791 missense possibly damaging 0.59
R4713:Scn10a UTSW 9 119609651 missense probably damaging 1.00
R4729:Scn10a UTSW 9 119671526 missense probably damaging 1.00
R4782:Scn10a UTSW 9 119622910 missense possibly damaging 0.70
R4822:Scn10a UTSW 9 119638672 missense probably damaging 1.00
R4856:Scn10a UTSW 9 119694309 missense possibly damaging 0.46
R4856:Scn10a UTSW 9 119694310 missense possibly damaging 0.63
R4932:Scn10a UTSW 9 119687874 splice site probably null
R5015:Scn10a UTSW 9 119622921 missense possibly damaging 0.93
R5193:Scn10a UTSW 9 119609655 missense probably damaging 1.00
R5211:Scn10a UTSW 9 119661232 missense possibly damaging 0.87
R5320:Scn10a UTSW 9 119648109 missense probably damaging 1.00
R5400:Scn10a UTSW 9 119609034 missense probably damaging 0.99
R5448:Scn10a UTSW 9 119687947 missense probably benign 0.25
R5457:Scn10a UTSW 9 119694127 missense probably damaging 1.00
R5554:Scn10a UTSW 9 119694130 missense probably benign 0.01
R5680:Scn10a UTSW 9 119624136 missense probably damaging 1.00
R5762:Scn10a UTSW 9 119635441 critical splice donor site probably null
R5935:Scn10a UTSW 9 119627171 missense probably damaging 0.99
R5956:Scn10a UTSW 9 119631560 missense probably damaging 1.00
R6041:Scn10a UTSW 9 119609469 missense probably damaging 1.00
R6047:Scn10a UTSW 9 119622831 missense probably benign 0.20
R6132:Scn10a UTSW 9 119613695 missense possibly damaging 0.94
R6156:Scn10a UTSW 9 119635583 missense probably benign 0.00
R6309:Scn10a UTSW 9 119624115 missense possibly damaging 0.95
R6318:Scn10a UTSW 9 119627115 missense probably damaging 1.00
R6394:Scn10a UTSW 9 119661320 missense probably benign 0.36
R6711:Scn10a UTSW 9 119609913 missense probably damaging 1.00
R6751:Scn10a UTSW 9 119671551 missense probably damaging 1.00
R6877:Scn10a UTSW 9 119609782 missense probably damaging 0.96
R6909:Scn10a UTSW 9 119609790 missense probably damaging 1.00
R7023:Scn10a UTSW 9 119613544 missense probably damaging 0.99
R7205:Scn10a UTSW 9 119613550 missense probably damaging 0.99
R7254:Scn10a UTSW 9 119618855 missense probably damaging 0.99
R7261:Scn10a UTSW 9 119609724 missense probably damaging 0.97
R7283:Scn10a UTSW 9 119664779 critical splice donor site probably null
R7453:Scn10a UTSW 9 119638552 missense probably benign
R7561:Scn10a UTSW 9 119694324 start codon destroyed probably null 0.66
R7590:Scn10a UTSW 9 119666400 missense probably damaging 1.00
R7765:Scn10a UTSW 9 119609904 missense possibly damaging 0.90
R7851:Scn10a UTSW 9 119617762 missense probably damaging 0.99
R7875:Scn10a UTSW 9 119635442 critical splice donor site probably null
R7934:Scn10a UTSW 9 119617762 missense probably damaging 0.99
R7958:Scn10a UTSW 9 119635442 critical splice donor site probably null
R8010:Scn10a UTSW 9 119661167 missense possibly damaging 0.56
R8027:Scn10a UTSW 9 119633790 missense probably damaging 0.99
X0058:Scn10a UTSW 9 119609364 nonsense probably null
Z1177:Scn10a UTSW 9 119624145 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TAGAGTCCCCAGACACACAGTG -3'
(R):5'- TGGCTCAGAAATTCCCATCTAC -3'

Sequencing Primer
(F):5'- GACACACAGTGCCTGTCC -3'
(R):5'- CTGGAGTTACAAGCATGTGCCAC -3'
Posted On2019-11-26