Incidental Mutation 'R7759:Arid5b'
ID 597736
Institutional Source Beutler Lab
Gene Symbol Arid5b
Ensembl Gene ENSMUSG00000019947
Gene Name AT-rich interaction domain 5B
Synonyms Mrf2alpha, Mrf2beta, Mrf2, 5430435G07Rik, Desrt
MMRRC Submission 045815-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.941) question?
Stock # R7759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 67928350-68114570 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 67933632 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 757 (S757C)
Ref Sequence ENSEMBL: ENSMUSP00000151227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020106] [ENSMUST00000218532] [ENSMUST00000219238]
AlphaFold Q8BM75
Predicted Effect probably benign
Transcript: ENSMUST00000020106
SMART Domains Protein: ENSMUSP00000020106
Gene: ENSMUSG00000019947

DomainStartEndE-ValueType
ARID 316 407 8.29e-35 SMART
BRIGHT 320 412 4.18e-38 SMART
low complexity region 425 438 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
low complexity region 695 718 N/A INTRINSIC
low complexity region 730 741 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218532
AA Change: S514C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000219238
AA Change: S757C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene experience a high level of mortality perinatally or earlier. Growth rates are low and mice remain small throughout live. There are abnormalities in various organ systems as well as the reproductive system. Fertility is reduced. [provided by MGI curators]
Allele List at MGI

All alleles(212) : Targeted, knock-out(2) Gene trapped(210)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G T 16: 4,682,514 (GRCm39) G215V probably benign Het
Adamts1 C A 16: 85,594,683 (GRCm39) G652C probably damaging Het
Adck1 G A 12: 88,368,887 (GRCm39) A122T possibly damaging Het
Akap1 A C 11: 88,736,659 (GRCm39) M34R probably damaging Het
Apc2 C T 10: 80,147,030 (GRCm39) R695C probably damaging Het
Apon T A 10: 128,090,384 (GRCm39) W21R probably benign Het
Arhgef16 T C 4: 154,371,432 (GRCm39) T254A probably benign Het
B020004C17Rik A C 14: 57,254,242 (GRCm39) I122L possibly damaging Het
Bckdhb T G 9: 83,892,379 (GRCm39) V270G probably damaging Het
Cacna1d A G 14: 29,821,145 (GRCm39) Y1146H probably benign Het
Carmil2 A G 8: 106,423,668 (GRCm39) D1214G possibly damaging Het
Ccdc142 T C 6: 83,084,912 (GRCm39) V636A probably benign Het
Chd9 T C 8: 91,704,178 (GRCm39) probably null Het
Csmd3 A G 15: 47,561,569 (GRCm39) S1336P Het
Cubn A G 2: 13,352,961 (GRCm39) Y1926H probably damaging Het
Dock4 A T 12: 40,867,735 (GRCm39) D1437V probably damaging Het
Eme1 A T 11: 94,536,666 (GRCm39) Y504* probably null Het
Enah G A 1: 181,746,009 (GRCm39) A687V unknown Het
Endou A C 15: 97,611,747 (GRCm39) V339G probably damaging Het
Ephb6 G A 6: 41,591,539 (GRCm39) R232H probably benign Het
Ephx2 G A 14: 66,326,968 (GRCm39) A409V possibly damaging Het
Esd T A 14: 74,983,007 (GRCm39) C219* probably null Het
Fscb A T 12: 64,520,866 (GRCm39) M200K probably benign Het
Gabra6 A T 11: 42,208,508 (GRCm39) V108D probably damaging Het
Gm11555 A G 11: 99,540,568 (GRCm39) V137A unknown Het
Gpld1 A G 13: 25,146,383 (GRCm39) D209G probably damaging Het
Ikzf1 T A 11: 11,719,256 (GRCm39) I408N probably damaging Het
Itgb4 A G 11: 115,894,536 (GRCm39) R1364G possibly damaging Het
Kif26b A C 1: 178,506,509 (GRCm39) K195T probably damaging Het
Mfsd12 T C 10: 81,199,427 (GRCm39) W440R probably benign Het
Mtrr C T 13: 68,718,146 (GRCm39) E373K probably damaging Het
Mug2 T A 6: 122,058,317 (GRCm39) V1293E probably damaging Het
Myof C A 19: 37,928,346 (GRCm39) A1068S probably benign Het
Ncam2 A G 16: 81,412,672 (GRCm39) D720G probably damaging Het
Nova2 G T 7: 18,692,176 (GRCm39) G435V Het
Oacyl T A 18: 65,843,631 (GRCm39) D109E probably damaging Het
Or2y1g A T 11: 49,171,463 (GRCm39) M163L probably benign Het
Or56a4 G A 7: 104,806,232 (GRCm39) S219F probably damaging Het
Pdcd11 G A 19: 47,101,637 (GRCm39) V941M possibly damaging Het
Pdzd8 C A 19: 59,288,358 (GRCm39) R1014L probably damaging Het
Ppm1h T G 10: 122,740,018 (GRCm39) D364E probably benign Het
Rigi C A 4: 40,225,104 (GRCm39) A298S probably damaging Het
Rp1 T C 1: 4,415,107 (GRCm39) N2002D probably benign Het
Sall1 C T 8: 89,768,979 (GRCm39) probably null Het
Scn10a C T 9: 119,477,198 (GRCm39) W728* probably null Het
Setdb2 G T 14: 59,656,813 (GRCm39) T168K probably damaging Het
Sgms1 T C 19: 32,137,276 (GRCm39) I97V probably benign Het
Slc8a3 A T 12: 81,361,325 (GRCm39) M498K probably benign Het
Smpd4 A T 16: 17,456,497 (GRCm39) E362D probably damaging Het
Ssc5d A T 7: 4,940,529 (GRCm39) K881* probably null Het
Strn4 A G 7: 16,564,309 (GRCm39) E313G probably damaging Het
Tas2r113 A T 6: 132,870,890 (GRCm39) N306I possibly damaging Het
Tdrd6 G T 17: 43,935,730 (GRCm39) R1773S probably benign Het
Thbs2 T C 17: 14,897,321 (GRCm39) E729G probably damaging Het
Tnfrsf23 G A 7: 143,224,572 (GRCm39) T135I probably damaging Het
Tollip A G 7: 141,438,276 (GRCm39) M218T probably benign Het
Tyk2 A T 9: 21,031,554 (GRCm39) probably null Het
Ubr2 G A 17: 47,296,974 (GRCm39) R269C probably damaging Het
Uggt1 A T 1: 36,185,806 (GRCm39) M1459K possibly damaging Het
Upf1 A G 8: 70,786,730 (GRCm39) V929A probably benign Het
Usp48 T C 4: 137,321,763 (GRCm39) S24P probably benign Het
Vmn1r214 G A 13: 23,218,631 (GRCm39) E42K not run Het
Vmn1r83 G T 7: 12,055,360 (GRCm39) D232E probably benign Het
Vmn2r25 C T 6: 123,800,339 (GRCm39) V668I probably damaging Het
Vmn2r6 A G 3: 64,463,991 (GRCm39) I281T probably damaging Het
Ywhag A T 5: 135,940,043 (GRCm39) Y184N probably damaging Het
Zdbf2 A C 1: 63,347,535 (GRCm39) E1971D possibly damaging Het
Zfp568 G A 7: 29,722,839 (GRCm39) A595T possibly damaging Het
Zfy2 T C Y: 2,117,083 (GRCm39) D248G probably benign Het
Other mutations in Arid5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Arid5b APN 10 67,964,805 (GRCm39) missense probably damaging 0.96
IGL01731:Arid5b APN 10 67,933,439 (GRCm39) missense probably damaging 1.00
IGL02069:Arid5b APN 10 67,933,229 (GRCm39) missense probably damaging 1.00
IGL02161:Arid5b APN 10 67,932,498 (GRCm39) missense probably benign 0.00
IGL02555:Arid5b APN 10 67,937,734 (GRCm39) missense probably benign 0.01
IGL02873:Arid5b APN 10 67,937,780 (GRCm39) missense probably benign 0.06
IGL03119:Arid5b APN 10 68,079,057 (GRCm39) missense probably damaging 1.00
IGL03271:Arid5b APN 10 67,933,287 (GRCm39) missense possibly damaging 0.73
gobi UTSW 10 67,954,175 (GRCm39) missense possibly damaging 0.92
3-1:Arid5b UTSW 10 67,934,419 (GRCm39) missense probably damaging 1.00
PIT4677001:Arid5b UTSW 10 67,933,841 (GRCm39) missense probably damaging 0.99
R0108:Arid5b UTSW 10 68,114,559 (GRCm39) utr 5 prime probably benign
R0525:Arid5b UTSW 10 67,933,676 (GRCm39) missense possibly damaging 0.90
R0533:Arid5b UTSW 10 68,021,863 (GRCm39) missense probably damaging 1.00
R0646:Arid5b UTSW 10 67,932,807 (GRCm39) missense probably damaging 1.00
R1066:Arid5b UTSW 10 67,934,186 (GRCm39) missense probably benign 0.04
R1487:Arid5b UTSW 10 67,933,044 (GRCm39) nonsense probably null
R1638:Arid5b UTSW 10 68,113,777 (GRCm39) missense possibly damaging 0.48
R1789:Arid5b UTSW 10 68,021,897 (GRCm39) missense probably damaging 0.99
R2031:Arid5b UTSW 10 68,114,518 (GRCm39) critical splice donor site probably null
R2337:Arid5b UTSW 10 67,933,607 (GRCm39) missense possibly damaging 0.63
R2996:Arid5b UTSW 10 67,934,292 (GRCm39) missense probably benign 0.01
R2997:Arid5b UTSW 10 67,934,292 (GRCm39) missense probably benign 0.01
R3547:Arid5b UTSW 10 67,934,292 (GRCm39) missense probably benign 0.01
R4411:Arid5b UTSW 10 67,932,519 (GRCm39) missense probably damaging 1.00
R4860:Arid5b UTSW 10 68,078,925 (GRCm39) missense probably damaging 0.97
R4860:Arid5b UTSW 10 68,078,925 (GRCm39) missense probably damaging 0.97
R5219:Arid5b UTSW 10 68,113,940 (GRCm39) missense probably benign 0.08
R5341:Arid5b UTSW 10 68,113,957 (GRCm39) missense possibly damaging 0.87
R5434:Arid5b UTSW 10 67,932,719 (GRCm39) missense possibly damaging 0.67
R5757:Arid5b UTSW 10 67,937,909 (GRCm39) missense probably damaging 1.00
R6114:Arid5b UTSW 10 67,933,574 (GRCm39) missense possibly damaging 0.89
R6313:Arid5b UTSW 10 67,933,412 (GRCm39) missense possibly damaging 0.95
R6338:Arid5b UTSW 10 67,934,391 (GRCm39) nonsense probably null
R6525:Arid5b UTSW 10 67,933,496 (GRCm39) missense possibly damaging 0.47
R6915:Arid5b UTSW 10 68,022,042 (GRCm39) nonsense probably null
R7013:Arid5b UTSW 10 67,933,649 (GRCm39) missense probably damaging 1.00
R7099:Arid5b UTSW 10 67,934,009 (GRCm39) missense probably damaging 1.00
R7260:Arid5b UTSW 10 67,933,637 (GRCm39) missense probably damaging 1.00
R7324:Arid5b UTSW 10 67,964,752 (GRCm39) missense probably benign 0.44
R7334:Arid5b UTSW 10 68,079,007 (GRCm39) missense possibly damaging 0.61
R7432:Arid5b UTSW 10 67,954,096 (GRCm39) missense probably damaging 1.00
R7453:Arid5b UTSW 10 68,078,994 (GRCm39) missense probably benign 0.01
R7649:Arid5b UTSW 10 67,954,175 (GRCm39) missense possibly damaging 0.92
R7659:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7661:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7662:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7663:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7665:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7666:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7779:Arid5b UTSW 10 67,932,606 (GRCm39) missense probably damaging 1.00
R7788:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7789:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7875:Arid5b UTSW 10 67,964,771 (GRCm39) missense probably benign 0.02
R8079:Arid5b UTSW 10 67,934,186 (GRCm39) missense possibly damaging 0.88
R8096:Arid5b UTSW 10 68,021,982 (GRCm39) missense probably benign 0.00
R8228:Arid5b UTSW 10 68,114,536 (GRCm39) missense possibly damaging 0.95
R8377:Arid5b UTSW 10 67,933,217 (GRCm39) missense probably damaging 0.96
R8757:Arid5b UTSW 10 67,933,640 (GRCm39) missense probably damaging 1.00
R8910:Arid5b UTSW 10 67,934,108 (GRCm39) missense
R8954:Arid5b UTSW 10 67,937,810 (GRCm39) missense possibly damaging 0.88
R9234:Arid5b UTSW 10 67,964,628 (GRCm39) missense possibly damaging 0.82
R9272:Arid5b UTSW 10 67,937,882 (GRCm39) missense probably damaging 0.99
R9430:Arid5b UTSW 10 68,022,087 (GRCm39) critical splice acceptor site probably null
X0066:Arid5b UTSW 10 67,954,132 (GRCm39) missense probably damaging 1.00
Z1177:Arid5b UTSW 10 67,933,058 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGACGGCTCTCTTCTCTAACAG -3'
(R):5'- TCATGTCCCCATTGGCTAAG -3'

Sequencing Primer
(F):5'- AACAGTTTATCTTTGCCCTCCTGTG -3'
(R):5'- TGTCCCCATTGGCTAAGAAAAAG -3'
Posted On 2019-11-26