Incidental Mutation 'R7759:Apc2'
ID 597737
Institutional Source Beutler Lab
Gene Symbol Apc2
Ensembl Gene ENSMUSG00000020135
Gene Name adenomatosis polyposis coli 2
Synonyms APCL
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock # R7759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 80295977-80318263 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 80311196 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 695 (R695C)
Ref Sequence ENSEMBL: ENSMUSP00000100996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020349] [ENSMUST00000105359]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000020349
AA Change: R666C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020349
Gene: ENSMUSG00000020135
AA Change: R666C

DomainStartEndE-ValueType
PDB:1DEB|B 4 57 9e-17 PDB
Pfam:Suppressor_APC 123 205 1.3e-28 PFAM
coiled coil region 214 236 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
ARM 300 355 2.95e0 SMART
ARM 417 468 2.22e-2 SMART
ARM 470 511 3.22e0 SMART
ARM 513 555 3.56e-1 SMART
ARM 557 602 2.1e1 SMART
ARM 607 647 1.82e-7 SMART
Blast:ARM 649 689 6e-18 BLAST
low complexity region 772 792 N/A INTRINSIC
low complexity region 817 844 N/A INTRINSIC
low complexity region 859 870 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1087 1103 N/A INTRINSIC
Pfam:APC_crr 1134 1159 4.4e-9 PFAM
low complexity region 1197 1208 N/A INTRINSIC
Pfam:APC_crr 1244 1269 4.1e-8 PFAM
Pfam:SAMP 1323 1343 2.1e-10 PFAM
Pfam:APC_crr 1369 1394 5.8e-8 PFAM
low complexity region 1500 1516 N/A INTRINSIC
Pfam:APC_crr 1540 1565 5.7e-8 PFAM
Pfam:SAMP 1594 1613 8.8e-11 PFAM
low complexity region 1673 1699 N/A INTRINSIC
Pfam:APC_basic 1757 2093 1.1e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105359
AA Change: R695C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100996
Gene: ENSMUSG00000020135
AA Change: R695C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:APC_N_CC 30 81 2.7e-34 PFAM
Pfam:Suppressor_APC 148 228 1.4e-27 PFAM
coiled coil region 238 260 N/A INTRINSIC
low complexity region 266 285 N/A INTRINSIC
ARM 324 379 2.95e0 SMART
ARM 446 497 2.22e-2 SMART
ARM 499 540 3.22e0 SMART
ARM 542 584 3.56e-1 SMART
ARM 586 631 2.1e1 SMART
ARM 636 676 1.82e-7 SMART
Blast:ARM 678 718 6e-18 BLAST
Pfam:Arm_APC_u3 719 977 1.1e-26 PFAM
low complexity region 1000 1009 N/A INTRINSIC
low complexity region 1086 1098 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
Pfam:APC_crr 1164 1187 9.3e-8 PFAM
low complexity region 1226 1237 N/A INTRINSIC
Pfam:APC_crr 1274 1297 7.9e-10 PFAM
Pfam:APC_crr 1399 1423 1.3e-9 PFAM
low complexity region 1529 1545 N/A INTRINSIC
low complexity region 1585 1603 N/A INTRINSIC
Pfam:SAMP 1624 1642 1.3e-11 PFAM
low complexity region 1702 1728 N/A INTRINSIC
Pfam:APC_basic 1786 2122 1.3e-122 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display gradual postnatal growth retardation, abnormal lamination of the cerebral cortex, hippocampus, olfactory bulb and cerebellum, impaired neuronal migration and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G T 16: 4,864,650 G215V probably benign Het
Adamts1 C A 16: 85,797,795 G652C probably damaging Het
Adck1 G A 12: 88,402,117 A122T possibly damaging Het
Akap1 A C 11: 88,845,833 M34R probably damaging Het
Apon T A 10: 128,254,515 W21R probably benign Het
Arhgef16 T C 4: 154,286,975 T254A probably benign Het
Arid5b T A 10: 68,097,802 S757C probably damaging Het
B020004C17Rik A C 14: 57,016,785 I122L possibly damaging Het
Bckdhb T G 9: 84,010,326 V270G probably damaging Het
Cacna1d A G 14: 30,099,188 Y1146H probably benign Het
Carmil2 A G 8: 105,697,036 D1214G possibly damaging Het
Ccdc142 T C 6: 83,107,931 V636A probably benign Het
Chd9 T C 8: 90,977,550 probably null Het
Csmd3 A G 15: 47,698,173 S1336P Het
Cubn A G 2: 13,348,150 Y1926H probably damaging Het
Ddx58 C A 4: 40,225,104 A298S probably damaging Het
Dock4 A T 12: 40,817,736 D1437V probably damaging Het
Eme1 A T 11: 94,645,840 Y504* probably null Het
Enah G A 1: 181,918,444 A687V unknown Het
Endou A C 15: 97,713,866 V339G probably damaging Het
Ephb6 G A 6: 41,614,605 R232H probably benign Het
Ephx2 G A 14: 66,089,519 A409V possibly damaging Het
Esd T A 14: 74,745,567 C219* probably null Het
Fscb A T 12: 64,474,092 M200K probably benign Het
Gabra6 A T 11: 42,317,681 V108D probably damaging Het
Gm11555 A G 11: 99,649,742 V137A unknown Het
Gpld1 A G 13: 24,962,400 D209G probably damaging Het
Ikzf1 T A 11: 11,769,256 I408N probably damaging Het
Itgb4 A G 11: 116,003,710 R1364G possibly damaging Het
Kif26b A C 1: 178,678,944 K195T probably damaging Het
Mfsd12 T C 10: 81,363,593 W440R probably benign Het
Mtrr C T 13: 68,570,027 E373K probably damaging Het
Mug2 T A 6: 122,081,358 V1293E probably damaging Het
Myof C A 19: 37,939,898 A1068S probably benign Het
Ncam2 A G 16: 81,615,784 D720G probably damaging Het
Nova2 G T 7: 18,958,251 G435V Het
Oacyl T A 18: 65,710,560 D109E probably damaging Het
Olfr1393 A T 11: 49,280,636 M163L probably benign Het
Olfr684 G A 7: 105,157,025 S219F probably damaging Het
Pdcd11 G A 19: 47,113,198 V941M possibly damaging Het
Pdzd8 C A 19: 59,299,926 R1014L probably damaging Het
Ppm1h T G 10: 122,904,113 D364E probably benign Het
Rp1 T C 1: 4,344,884 N2002D probably benign Het
Sall1 C T 8: 89,042,351 probably null Het
Scn10a C T 9: 119,648,132 W728* probably null Het
Setdb2 G T 14: 59,419,364 T168K probably damaging Het
Sgms1 T C 19: 32,159,876 I97V probably benign Het
Slc8a3 A T 12: 81,314,551 M498K probably benign Het
Smpd4 A T 16: 17,638,633 E362D probably damaging Het
Ssc5d A T 7: 4,937,530 K881* probably null Het
Strn4 A G 7: 16,830,384 E313G probably damaging Het
Tas2r113 A T 6: 132,893,927 N306I possibly damaging Het
Tdrd6 G T 17: 43,624,839 R1773S probably benign Het
Thbs2 T C 17: 14,677,059 E729G probably damaging Het
Tnfrsf23 G A 7: 143,670,835 T135I probably damaging Het
Tollip A G 7: 141,884,539 M218T probably benign Het
Tyk2 A T 9: 21,120,258 probably null Het
Ubr2 G A 17: 46,986,048 R269C probably damaging Het
Uggt1 A T 1: 36,146,725 M1459K possibly damaging Het
Upf1 A G 8: 70,334,080 V929A probably benign Het
Usp48 T C 4: 137,594,452 S24P probably benign Het
Vmn1r214 G A 13: 23,034,461 E42K not run Het
Vmn1r83 G T 7: 12,321,433 D232E probably benign Het
Vmn2r25 C T 6: 123,823,380 V668I probably damaging Het
Vmn2r6 A G 3: 64,556,570 I281T probably damaging Het
Ywhag A T 5: 135,911,189 Y184N probably damaging Het
Zdbf2 A C 1: 63,308,376 E1971D possibly damaging Het
Zfp568 G A 7: 30,023,414 A595T possibly damaging Het
Zfy2 T C Y: 2,117,083 D248G probably benign Het
Other mutations in Apc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Apc2 APN 10 80311986 missense probably damaging 1.00
IGL01154:Apc2 APN 10 80313069 missense possibly damaging 0.90
IGL01411:Apc2 APN 10 80315078 missense probably damaging 0.99
IGL01598:Apc2 APN 10 80313048 missense probably damaging 1.00
IGL01621:Apc2 APN 10 80306201 missense probably damaging 1.00
IGL01720:Apc2 APN 10 80314499 missense probably benign 0.01
IGL01837:Apc2 APN 10 80314658 missense probably benign 0.24
IGL01933:Apc2 APN 10 80311740 missense probably damaging 1.00
IGL02243:Apc2 APN 10 80302341 missense probably damaging 1.00
IGL02292:Apc2 APN 10 80302424 missense possibly damaging 0.59
IGL02956:Apc2 APN 10 80306375 missense probably damaging 1.00
IGL03081:Apc2 APN 10 80312252 missense probably damaging 1.00
IGL03172:Apc2 APN 10 80313386 missense probably damaging 0.98
LCD18:Apc2 UTSW 10 80299974 intron probably benign
R0278:Apc2 UTSW 10 80312813 missense possibly damaging 0.90
R0501:Apc2 UTSW 10 80315124 missense probably damaging 1.00
R0594:Apc2 UTSW 10 80306256 nonsense probably null
R0607:Apc2 UTSW 10 80314101 missense probably benign
R0624:Apc2 UTSW 10 80314583 missense probably benign 0.00
R0633:Apc2 UTSW 10 80307455 missense probably damaging 0.99
R0638:Apc2 UTSW 10 80304967 missense probably damaging 0.99
R0647:Apc2 UTSW 10 80304928 missense probably damaging 1.00
R0830:Apc2 UTSW 10 80315405 missense probably damaging 1.00
R1071:Apc2 UTSW 10 80311502 missense probably damaging 1.00
R1221:Apc2 UTSW 10 80306380 missense probably damaging 1.00
R1432:Apc2 UTSW 10 80312349 missense probably benign 0.00
R1579:Apc2 UTSW 10 80311345 missense probably damaging 1.00
R1654:Apc2 UTSW 10 80301842 missense possibly damaging 0.75
R1700:Apc2 UTSW 10 80312769 missense probably damaging 1.00
R1774:Apc2 UTSW 10 80309130 missense probably damaging 1.00
R1864:Apc2 UTSW 10 80313648 missense probably damaging 1.00
R1908:Apc2 UTSW 10 80314844 missense probably benign 0.05
R1915:Apc2 UTSW 10 80315867 missense probably benign
R1999:Apc2 UTSW 10 80309160 missense probably damaging 1.00
R2050:Apc2 UTSW 10 80307609 splice site probably null
R2219:Apc2 UTSW 10 80309109 missense probably benign 0.41
R2393:Apc2 UTSW 10 80313069 missense possibly damaging 0.90
R3862:Apc2 UTSW 10 80307559 missense possibly damaging 0.82
R3900:Apc2 UTSW 10 80295972 splice site probably null
R3901:Apc2 UTSW 10 80315088 missense possibly damaging 0.94
R3952:Apc2 UTSW 10 80314484 missense probably damaging 1.00
R4009:Apc2 UTSW 10 80313592 missense probably benign 0.00
R4090:Apc2 UTSW 10 80305544 missense probably damaging 0.97
R4695:Apc2 UTSW 10 80311043 missense probably damaging 1.00
R4754:Apc2 UTSW 10 80314358 missense probably benign 0.01
R4807:Apc2 UTSW 10 80314362 missense probably benign 0.13
R4886:Apc2 UTSW 10 80314213 missense probably damaging 1.00
R4964:Apc2 UTSW 10 80314007 missense probably benign 0.14
R5056:Apc2 UTSW 10 80301314 missense probably benign
R5057:Apc2 UTSW 10 80309069 missense probably damaging 0.99
R5165:Apc2 UTSW 10 80315850 missense probably damaging 0.99
R5241:Apc2 UTSW 10 80312234 missense probably benign
R5649:Apc2 UTSW 10 80314138 missense probably damaging 1.00
R5924:Apc2 UTSW 10 80312150 missense probably damaging 1.00
R6124:Apc2 UTSW 10 80306351 missense probably damaging 0.98
R6218:Apc2 UTSW 10 80306420 missense probably damaging 0.98
R6376:Apc2 UTSW 10 80312654 missense probably damaging 1.00
R6490:Apc2 UTSW 10 80313923 missense probably benign 0.01
R6572:Apc2 UTSW 10 80311779 missense probably damaging 1.00
R6620:Apc2 UTSW 10 80313567 missense probably damaging 0.97
R7171:Apc2 UTSW 10 80315336 missense possibly damaging 0.65
R7180:Apc2 UTSW 10 80311156 missense possibly damaging 0.94
R7326:Apc2 UTSW 10 80311740 missense probably damaging 1.00
R7340:Apc2 UTSW 10 80313482 missense probably benign 0.12
R7378:Apc2 UTSW 10 80311394 missense probably damaging 1.00
R7384:Apc2 UTSW 10 80312624 missense probably damaging 1.00
R7431:Apc2 UTSW 10 80302183 missense possibly damaging 0.83
R7543:Apc2 UTSW 10 80314886 missense possibly damaging 0.72
R7743:Apc2 UTSW 10 80304915 missense probably damaging 0.99
R8244:Apc2 UTSW 10 80315332 missense probably damaging 0.99
R8327:Apc2 UTSW 10 80301930 missense probably damaging 1.00
R8489:Apc2 UTSW 10 80307464 missense probably damaging 1.00
R8494:Apc2 UTSW 10 80314479 missense probably damaging 1.00
R8669:Apc2 UTSW 10 80313657 missense probably damaging 1.00
R8773:Apc2 UTSW 10 80306212 missense probably damaging 1.00
R8920:Apc2 UTSW 10 80314100 missense probably benign
R9178:Apc2 UTSW 10 80314401 missense probably benign 0.11
R9224:Apc2 UTSW 10 80314277 missense probably damaging 0.97
R9357:Apc2 UTSW 10 80311038 missense probably damaging 1.00
R9394:Apc2 UTSW 10 80309172 missense probably damaging 1.00
R9666:Apc2 UTSW 10 80311349 missense possibly damaging 0.57
R9689:Apc2 UTSW 10 80314899 missense probably damaging 1.00
X0018:Apc2 UTSW 10 80312264 missense probably benign 0.02
Z1177:Apc2 UTSW 10 80312036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACTGGAGTAAAGCCCAC -3'
(R):5'- TAAGTGACCGAGTGCATGC -3'

Sequencing Primer
(F):5'- GTTTGACCATCGTGAGCA -3'
(R):5'- AGGTGCCGAGTGTCCAAC -3'
Posted On 2019-11-26