Incidental Mutation 'R7759:Apon'
ID 597740
Institutional Source Beutler Lab
Gene Symbol Apon
Ensembl Gene ENSMUSG00000051716
Gene Name apolipoprotein N
Synonyms D10Ucla2
MMRRC Submission 045815-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R7759 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 128090000-128091770 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 128090384 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 21 (W21R)
Ref Sequence ENSEMBL: ENSMUSP00000059142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055539] [ENSMUST00000060782] [ENSMUST00000105242] [ENSMUST00000105244] [ENSMUST00000105245] [ENSMUST00000218722]
AlphaFold G3X9D6
Predicted Effect probably benign
Transcript: ENSMUST00000055539
SMART Domains Protein: ENSMUSP00000058021
Gene: ENSMUSG00000039994

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.2e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060782
AA Change: W21R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000059142
Gene: ENSMUSG00000051716
AA Change: W21R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipo_F 50 247 2.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105242
SMART Domains Protein: ENSMUSP00000100876
Gene: ENSMUSG00000039994

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.1e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 4.4e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105244
SMART Domains Protein: ENSMUSP00000100878
Gene: ENSMUSG00000039994

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.3e-103 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 5e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105245
SMART Domains Protein: ENSMUSP00000100879
Gene: ENSMUSG00000039994

DomainStartEndE-ValueType
Pfam:TIMELESS 24 284 1.1e-81 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218722
AA Change: W21R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G T 16: 4,682,514 (GRCm39) G215V probably benign Het
Adamts1 C A 16: 85,594,683 (GRCm39) G652C probably damaging Het
Adck1 G A 12: 88,368,887 (GRCm39) A122T possibly damaging Het
Akap1 A C 11: 88,736,659 (GRCm39) M34R probably damaging Het
Apc2 C T 10: 80,147,030 (GRCm39) R695C probably damaging Het
Arhgef16 T C 4: 154,371,432 (GRCm39) T254A probably benign Het
Arid5b T A 10: 67,933,632 (GRCm39) S757C probably damaging Het
B020004C17Rik A C 14: 57,254,242 (GRCm39) I122L possibly damaging Het
Bckdhb T G 9: 83,892,379 (GRCm39) V270G probably damaging Het
Cacna1d A G 14: 29,821,145 (GRCm39) Y1146H probably benign Het
Carmil2 A G 8: 106,423,668 (GRCm39) D1214G possibly damaging Het
Ccdc142 T C 6: 83,084,912 (GRCm39) V636A probably benign Het
Chd9 T C 8: 91,704,178 (GRCm39) probably null Het
Csmd3 A G 15: 47,561,569 (GRCm39) S1336P Het
Cubn A G 2: 13,352,961 (GRCm39) Y1926H probably damaging Het
Dock4 A T 12: 40,867,735 (GRCm39) D1437V probably damaging Het
Eme1 A T 11: 94,536,666 (GRCm39) Y504* probably null Het
Enah G A 1: 181,746,009 (GRCm39) A687V unknown Het
Endou A C 15: 97,611,747 (GRCm39) V339G probably damaging Het
Ephb6 G A 6: 41,591,539 (GRCm39) R232H probably benign Het
Ephx2 G A 14: 66,326,968 (GRCm39) A409V possibly damaging Het
Esd T A 14: 74,983,007 (GRCm39) C219* probably null Het
Fscb A T 12: 64,520,866 (GRCm39) M200K probably benign Het
Gabra6 A T 11: 42,208,508 (GRCm39) V108D probably damaging Het
Gm11555 A G 11: 99,540,568 (GRCm39) V137A unknown Het
Gpld1 A G 13: 25,146,383 (GRCm39) D209G probably damaging Het
Ikzf1 T A 11: 11,719,256 (GRCm39) I408N probably damaging Het
Itgb4 A G 11: 115,894,536 (GRCm39) R1364G possibly damaging Het
Kif26b A C 1: 178,506,509 (GRCm39) K195T probably damaging Het
Mfsd12 T C 10: 81,199,427 (GRCm39) W440R probably benign Het
Mtrr C T 13: 68,718,146 (GRCm39) E373K probably damaging Het
Mug2 T A 6: 122,058,317 (GRCm39) V1293E probably damaging Het
Myof C A 19: 37,928,346 (GRCm39) A1068S probably benign Het
Ncam2 A G 16: 81,412,672 (GRCm39) D720G probably damaging Het
Nova2 G T 7: 18,692,176 (GRCm39) G435V Het
Oacyl T A 18: 65,843,631 (GRCm39) D109E probably damaging Het
Or2y1g A T 11: 49,171,463 (GRCm39) M163L probably benign Het
Or56a4 G A 7: 104,806,232 (GRCm39) S219F probably damaging Het
Pdcd11 G A 19: 47,101,637 (GRCm39) V941M possibly damaging Het
Pdzd8 C A 19: 59,288,358 (GRCm39) R1014L probably damaging Het
Ppm1h T G 10: 122,740,018 (GRCm39) D364E probably benign Het
Rigi C A 4: 40,225,104 (GRCm39) A298S probably damaging Het
Rp1 T C 1: 4,415,107 (GRCm39) N2002D probably benign Het
Sall1 C T 8: 89,768,979 (GRCm39) probably null Het
Scn10a C T 9: 119,477,198 (GRCm39) W728* probably null Het
Setdb2 G T 14: 59,656,813 (GRCm39) T168K probably damaging Het
Sgms1 T C 19: 32,137,276 (GRCm39) I97V probably benign Het
Slc8a3 A T 12: 81,361,325 (GRCm39) M498K probably benign Het
Smpd4 A T 16: 17,456,497 (GRCm39) E362D probably damaging Het
Ssc5d A T 7: 4,940,529 (GRCm39) K881* probably null Het
Strn4 A G 7: 16,564,309 (GRCm39) E313G probably damaging Het
Tas2r113 A T 6: 132,870,890 (GRCm39) N306I possibly damaging Het
Tdrd6 G T 17: 43,935,730 (GRCm39) R1773S probably benign Het
Thbs2 T C 17: 14,897,321 (GRCm39) E729G probably damaging Het
Tnfrsf23 G A 7: 143,224,572 (GRCm39) T135I probably damaging Het
Tollip A G 7: 141,438,276 (GRCm39) M218T probably benign Het
Tyk2 A T 9: 21,031,554 (GRCm39) probably null Het
Ubr2 G A 17: 47,296,974 (GRCm39) R269C probably damaging Het
Uggt1 A T 1: 36,185,806 (GRCm39) M1459K possibly damaging Het
Upf1 A G 8: 70,786,730 (GRCm39) V929A probably benign Het
Usp48 T C 4: 137,321,763 (GRCm39) S24P probably benign Het
Vmn1r214 G A 13: 23,218,631 (GRCm39) E42K not run Het
Vmn1r83 G T 7: 12,055,360 (GRCm39) D232E probably benign Het
Vmn2r25 C T 6: 123,800,339 (GRCm39) V668I probably damaging Het
Vmn2r6 A G 3: 64,463,991 (GRCm39) I281T probably damaging Het
Ywhag A T 5: 135,940,043 (GRCm39) Y184N probably damaging Het
Zdbf2 A C 1: 63,347,535 (GRCm39) E1971D possibly damaging Het
Zfp568 G A 7: 29,722,839 (GRCm39) A595T possibly damaging Het
Zfy2 T C Y: 2,117,083 (GRCm39) D248G probably benign Het
Other mutations in Apon
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02535:Apon APN 10 128,090,823 (GRCm39) missense probably damaging 1.00
IGL03340:Apon APN 10 128,090,847 (GRCm39) missense probably benign 0.01
R1704:Apon UTSW 10 128,090,865 (GRCm39) missense probably damaging 1.00
R2178:Apon UTSW 10 128,090,634 (GRCm39) missense probably benign 0.01
R4853:Apon UTSW 10 128,090,951 (GRCm39) missense probably benign 0.13
R5323:Apon UTSW 10 128,090,907 (GRCm39) missense probably damaging 1.00
R6385:Apon UTSW 10 128,090,223 (GRCm39) start gained probably benign
R7354:Apon UTSW 10 128,090,607 (GRCm39) missense probably benign 0.18
R7567:Apon UTSW 10 128,090,922 (GRCm39) missense possibly damaging 0.73
R7858:Apon UTSW 10 128,090,328 (GRCm39) missense probably benign 0.07
R8467:Apon UTSW 10 128,091,002 (GRCm39) missense probably benign
R8680:Apon UTSW 10 128,090,428 (GRCm39) missense probably benign 0.00
R9187:Apon UTSW 10 128,090,832 (GRCm39) missense probably benign 0.00
R9779:Apon UTSW 10 128,091,065 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CCCCTCTTATGTCCAGGGAAAC -3'
(R):5'- GGCAGCCAATGTTTTCCAGG -3'

Sequencing Primer
(F):5'- TGAAGTCTCTAATGACCAGGACTC -3'
(R):5'- ATGTTTTCCAGGACAACTCTCAGGG -3'
Posted On 2019-11-26