Incidental Mutation 'R7759:Eme1'
ID597745
Institutional Source Beutler Lab
Gene Symbol Eme1
Ensembl Gene ENSMUSG00000039055
Gene Nameessential meiotic structure-specific endonuclease 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7759 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location94644996-94653964 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 94645840 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 504 (Y504*)
Ref Sequence ENSEMBL: ENSMUSP00000036361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021239] [ENSMUST00000039949]
Predicted Effect probably benign
Transcript: ENSMUST00000021239
SMART Domains Protein: ENSMUSP00000021239
Gene: ENSMUSG00000020869

DomainStartEndE-ValueType
LRR 38 60 6.22e0 SMART
LRR 61 83 1.33e-1 SMART
LRR 84 106 3.75e0 SMART
LRR 107 131 1.09e2 SMART
coiled coil region 148 216 N/A INTRINSIC
transmembrane domain 244 266 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000039949
AA Change: Y504*
SMART Domains Protein: ENSMUSP00000036361
Gene: ENSMUSG00000039055
AA Change: Y504*

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
ERCC4 252 515 2.06e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that complexes with methyl methanesulfonate-sensitive UV-sensitive 81 protein to form an endonuclease complex. The encoded protein interacts with specifc DNA structures including nicked Holliday junctions, 3'-flap structures and aberrant replication fork structures. This protein may be involved in repairing DNA damage and in maintaining genomic stability. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G T 16: 4,864,650 G215V probably benign Het
Adamts1 C A 16: 85,797,795 G652C probably damaging Het
Adck1 G A 12: 88,402,117 A122T possibly damaging Het
Akap1 A C 11: 88,845,833 M34R probably damaging Het
Apc2 C T 10: 80,311,196 R695C probably damaging Het
Apon T A 10: 128,254,515 W21R probably benign Het
Arhgef16 T C 4: 154,286,975 T254A probably benign Het
Arid5b T A 10: 68,097,802 S757C probably damaging Het
B020004C17Rik A C 14: 57,016,785 I122L possibly damaging Het
Bckdhb T G 9: 84,010,326 V270G probably damaging Het
Cacna1d A G 14: 30,099,188 Y1146H probably benign Het
Carmil2 A G 8: 105,697,036 D1214G possibly damaging Het
Ccdc142 T C 6: 83,107,931 V636A probably benign Het
Chd9 T C 8: 90,977,550 probably null Het
Csmd3 A G 15: 47,698,173 S1336P Het
Cubn A G 2: 13,348,150 Y1926H probably damaging Het
Ddx58 C A 4: 40,225,104 A298S probably damaging Het
Dock4 A T 12: 40,817,736 D1437V probably damaging Het
Enah G A 1: 181,918,444 A687V unknown Het
Endou A C 15: 97,713,866 V339G probably damaging Het
Ephb6 G A 6: 41,614,605 R232H probably benign Het
Ephx2 G A 14: 66,089,519 A409V possibly damaging Het
Esd T A 14: 74,745,567 C219* probably null Het
Fscb A T 12: 64,474,092 M200K probably benign Het
Gabra6 A T 11: 42,317,681 V108D probably damaging Het
Gm11555 A G 11: 99,649,742 V137A unknown Het
Gpld1 A G 13: 24,962,400 D209G probably damaging Het
Ikzf1 T A 11: 11,769,256 I408N probably damaging Het
Itgb4 A G 11: 116,003,710 R1364G possibly damaging Het
Kif26b A C 1: 178,678,944 K195T probably damaging Het
Mfsd12 T C 10: 81,363,593 W440R probably benign Het
Mtrr C T 13: 68,570,027 E373K probably damaging Het
Mug2 T A 6: 122,081,358 V1293E probably damaging Het
Myof C A 19: 37,939,898 A1068S probably benign Het
Ncam2 A G 16: 81,615,784 D720G probably damaging Het
Nova2 G T 7: 18,958,251 G435V Het
Oacyl T A 18: 65,710,560 D109E probably damaging Het
Olfr1393 A T 11: 49,280,636 M163L probably benign Het
Olfr684 G A 7: 105,157,025 S219F probably damaging Het
Pdcd11 G A 19: 47,113,198 V941M possibly damaging Het
Pdzd8 C A 19: 59,299,926 R1014L probably damaging Het
Ppm1h T G 10: 122,904,113 D364E probably benign Het
Rp1 T C 1: 4,344,884 N2002D probably benign Het
Sall1 C T 8: 89,042,351 probably null Het
Scn10a C T 9: 119,648,132 W728* probably null Het
Setdb2 G T 14: 59,419,364 T168K probably damaging Het
Sgms1 T C 19: 32,159,876 I97V probably benign Het
Slc8a3 A T 12: 81,314,551 M498K probably benign Het
Smpd4 A T 16: 17,638,633 E362D probably damaging Het
Ssc5d A T 7: 4,937,530 K881* probably null Het
Strn4 A G 7: 16,830,384 E313G probably damaging Het
Tas2r113 A T 6: 132,893,927 N306I possibly damaging Het
Tdrd6 G T 17: 43,624,839 R1773S probably benign Het
Thbs2 T C 17: 14,677,059 E729G probably damaging Het
Tnfrsf23 G A 7: 143,670,835 T135I probably damaging Het
Tollip A G 7: 141,884,539 M218T probably benign Het
Tyk2 A T 9: 21,120,258 probably null Het
Ubr2 G A 17: 46,986,048 R269C probably damaging Het
Uggt1 A T 1: 36,146,725 M1459K possibly damaging Het
Upf1 A G 8: 70,334,080 V929A probably benign Het
Usp48 T C 4: 137,594,452 S24P probably benign Het
Vmn1r214 G A 13: 23,034,461 E42K not run Het
Vmn1r83 G T 7: 12,321,433 D232E probably benign Het
Vmn2r25 C T 6: 123,823,380 V668I probably damaging Het
Vmn2r6 A G 3: 64,556,570 I281T probably damaging Het
Ywhag A T 5: 135,911,189 Y184N probably damaging Het
Zdbf2 A C 1: 63,308,376 E1971D possibly damaging Het
Zfp568 G A 7: 30,023,414 A595T possibly damaging Het
Zfy2 T C Y: 2,117,083 D248G probably benign Het
Other mutations in Eme1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Eme1 APN 11 94645451 missense probably damaging 1.00
IGL02402:Eme1 APN 11 94650907 missense possibly damaging 0.65
R0220:Eme1 UTSW 11 94650258 missense probably null 1.00
R0594:Eme1 UTSW 11 94650430 missense possibly damaging 0.63
R0608:Eme1 UTSW 11 94650082 missense probably damaging 1.00
R0842:Eme1 UTSW 11 94650874 missense probably benign 0.24
R0925:Eme1 UTSW 11 94650732 missense probably damaging 0.99
R1146:Eme1 UTSW 11 94645451 missense probably damaging 1.00
R1146:Eme1 UTSW 11 94645451 missense probably damaging 1.00
R1161:Eme1 UTSW 11 94645542 missense probably damaging 1.00
R1310:Eme1 UTSW 11 94645542 missense probably damaging 1.00
R1837:Eme1 UTSW 11 94645961 missense probably benign 0.14
R2138:Eme1 UTSW 11 94648192 missense probably damaging 1.00
R2420:Eme1 UTSW 11 94645814 critical splice donor site probably null
R2427:Eme1 UTSW 11 94650975 unclassified probably benign
R3807:Eme1 UTSW 11 94650592 missense probably damaging 1.00
R4230:Eme1 UTSW 11 94647992 missense possibly damaging 0.69
R6889:Eme1 UTSW 11 94650477 missense probably benign 0.00
R7752:Eme1 UTSW 11 94650819 missense probably damaging 1.00
R7901:Eme1 UTSW 11 94650819 missense probably damaging 1.00
X0021:Eme1 UTSW 11 94650518 missense possibly damaging 0.56
Z1176:Eme1 UTSW 11 94650696 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GTGACCTCTTAACACCATGCC -3'
(R):5'- GAACTCAAGTCTCCAGTGGTGC -3'

Sequencing Primer
(F):5'- ATCGTACCACCCGTCCATG -3'
(R):5'- AAGTCTCCAGTGGTGCCCTTG -3'
Posted On2019-11-26